Rh7BG001800

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
137493 .. 137879
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG001800.1

Sequence Viewer

Length: 387 bp
ATGGAAGGTAGCATAATCGACGAAATGCCTCACTCAATTGGCCTACCCCTAGATGAACACATTTTCTTCACACTCATTCACGGTCTTGGCCGTGACCACTTGGTGAAGCAAATGGTTAAGGTGCTTGACTTGGTTGCCAGGTACAACCAAAAACCTTCTCTCAAGATATTCAATTCGATACTTGATGTCCTTGTAAAGGAAGACAGAGATATAGCTAAGGAGTTTTATAGGAAGAAGATGATGGCAAGTGGCGTCAAGGGTGATGAATATTATACTTCCGGTATCTTGATGAAAAGTTTTTGCTTGACTAATCGAATTGGTGATGGTTTTAAGCTTTTGCAAGTCATTGAATCGAGGGGAATTGCCCTGAAATATTTTGGTTTATAA

Protein Analysis

128

Amino Acids

14.61

Weight (kDa)

8.65

Isoelectric Point (pI)

28.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 385
AcoI YGGCCR 1 cut(s) 88
AcyI GRCGYC 1 cut(s) 252
AdeI CACNNNGTG 1 cut(s) 103
AfaI GTAC 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 196
AgsI TTSAA 2 cut(s) 172, 350
AjnI CCWGG 1 cut(s) 137
AluBI AGCT 2 cut(s) 215, 334
AluI AGCT 2 cut(s) 215, 334
AoxI GGCC 2 cut(s) 40, 88
AsuHPI GGTGA 3 cut(s) 115, 272, 332
BbsI GAAGAC 1 cut(s) 207
BccI CCATC 2 cut(s) 235, 317
BceAI ACGGC 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 139
BfaI CTAG 1 cut(s) 50
Bme1390I CCNGG 1 cut(s) 139
BmrFI CCNGG 1 cut(s) 139
BpiI GAAGAC 1 cut(s) 207
Bpu10I CCTNAGC 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 146
BsaHI GRCGYC 1 cut(s) 252
BsaWI WCCGGW 1 cut(s) 278
Bsc4I CCNNNNNNNGG 1 cut(s) 196
BseBI CCWGG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 196
BshFI GGCC 2 cut(s) 42, 90
BsiSI CCGG 1 cut(s) 279
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 2 cut(s) 42, 90
BspANI GGCC 2 cut(s) 42, 90
BssNI GRCGYC 1 cut(s) 252
Bst2UI CCWGG 1 cut(s) 139
Bst4CI ACNGT 1 cut(s) 83
BstACI GRCGYC 1 cut(s) 252
BstDEI CTNAG 1 cut(s) 216
BstENI CCTNNNNNAGG 1 cut(s) 194
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
BstV2I GAAGAC 1 cut(s) 207
BsuRI GGCC 2 cut(s) 42, 90
CseI GACGC 1 cut(s) 241
Csp6I GTAC 1 cut(s) 142
CviJI RGCY 4 cut(s) 42, 90, 215, 334
CviKI_1 RGCY 4 cut(s) 42, 90, 215, 334
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 1 cut(s) 216
DraIII CACNNNGTG 1 cut(s) 103
EaeI YGGCCR 1 cut(s) 88
EcoNI CCTNNNNNAGG 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 137
FaiI YATR 5 cut(s) 14, 212, 228, 273, 385
FspBI CTAG 1 cut(s) 50
HaeIII GGCC 2 cut(s) 42, 90
HapII CCGG 1 cut(s) 279
HgaI GACGC 1 cut(s) 241
Hin1I GRCGYC 1 cut(s) 252
HindIII AAGCTT 1 cut(s) 332
HinfI GANTC 1 cut(s) 350
HpaII CCGG 1 cut(s) 279
HphI GGTGA 3 cut(s) 115, 272, 332
Hpy188III TCNNGA 2 cut(s) 163, 286
Hpy99I CGWCG 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 165
HpyCH4III ACNGT 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 340
HpyF3I CTNAG 1 cut(s) 216
Hsp92I GRCGYC 1 cut(s) 252
LpnPI CCDG 4 cut(s) 124, 151, 292, 380
MaeI CTAG 1 cut(s) 50
MaeIII GTNAC 1 cut(s) 92
MboII GAAGA 4 cut(s) 58, 212, 244, 247
MfeI CAATTG 1 cut(s) 36
MluCI AATT 4 cut(s) 36, 172, 315, 360
MnlI CCTC 2 cut(s) 39, 348
MseI TTAA 2 cut(s) 117, 330
MspI CCGG 1 cut(s) 279
MspR9I CCNGG 1 cut(s) 139
MunI CAATTG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 92
PfeI GAWTC 1 cut(s) 350
PsiI TTATAA 1 cut(s) 385
Psp6I CCWGG 1 cut(s) 137
PspGI CCWGG 1 cut(s) 137
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 117, 330
ScrFI CCNGG 1 cut(s) 139
SetI ASST 6 cut(s) 10, 123, 143, 157, 217, 336
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 4 cut(s) 36, 172, 315, 360
SspI AATATT 2 cut(s) 269, 374
SspMI CTAG 1 cut(s) 50
StyD4I CCNGG 1 cut(s) 137
TaaI ACNGT 1 cut(s) 83
TaqI TCGA 4 cut(s) 18, 176, 313, 353
TasI AATT 4 cut(s) 36, 172, 315, 360
TfiI GAWTC 1 cut(s) 350
Tru1I TTAA 2 cut(s) 117, 330
Tru9I TTAA 2 cut(s) 117, 330
TseFI GTSAC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 3 cut(s) 69, 279, 305
XagI CCTNNNNNAGG 1 cut(s) 194
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.