Rroxscaffold_2G00150290

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
87696009 .. 87696773
765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00150290.1

Sequence Viewer

Length: 333 bp
ATGGCAAAGAACGACGCATCCTTGGGATCGGTGGGCGTGTTCTTGAAGCGATACCGACAATTTGGCGAGCCTTTGACGATCGACATCTCTAGAGATAGGAGCCAAACGCGCGAGATGAGGCATTACGATGATCTCCTTACCAACAGCTATTCTGTTGGTATGTCAAGGGAATGTGAAGTTAACATTGGGACAGGTTTGTTATTTTATCTCCAAAAAGCTTTAGGTTGTCAAACAACAACAAAATTCCAATTGGATTACTTCAGCGATTCTAGTTCACTCAAAGACCACAAACCAAGCTTCGACGATGTTCAGGTCTGGCCCGTTGCTTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.57

Weight (kDa)

6.06

Isoelectric Point (pI)

51.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 109, 111
AclWI GGATC 1 cut(s) 34
AcsI RAATTY 1 cut(s) 242
AcuI CTGAAG 1 cut(s) 244
AgsI TTSAA 1 cut(s) 46
AjuI GAANNNNNNNTTGG 2 cut(s) 168, 200
AloI GAACNNNNNNTCC 1 cut(s) 34
AluBI AGCT 3 cut(s) 147, 218, 297
AluI AGCT 3 cut(s) 147, 218, 297
AlwI GGATC 1 cut(s) 34
AoxI GGCC 1 cut(s) 317
ApoI RAATTY 1 cut(s) 242
AspLEI GCGC 1 cut(s) 111
AspS9I GGNCC 1 cut(s) 318
BfaI CTAG 2 cut(s) 90, 270
BmgT120I GGNCC 1 cut(s) 318
BmiI GGNNCC 1 cut(s) 101
BmsI GCATC 1 cut(s) 26
BsaBI GATNNNNATC 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 21
Bse8I GATNNNNATC 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 17
BseJI GATNNNNATC 1 cut(s) 83
Bsh1236I CGCG 2 cut(s) 109, 111
Bsh1285I CGRYCG 1 cut(s) 81
BshFI GGCC 1 cut(s) 319
BsiEI CGRYCG 1 cut(s) 81
BslFI GGGAC 1 cut(s) 202
BsmFI GGGAC 1 cut(s) 202
BsnI GGCC 1 cut(s) 319
Bsp143I GATC 3 cut(s) 26, 78, 130
BspANI GGCC 1 cut(s) 319
BspFNI CGCG 2 cut(s) 109, 111
BspLI GGNNCC 1 cut(s) 101
BspPI GGATC 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 21
BssMI GATC 3 cut(s) 26, 78, 130
BssT1I CCWWGG 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 68
BstF5I GGATG 1 cut(s) 17
BstFNI CGCG 2 cut(s) 109, 111
BstHHI GCGC 1 cut(s) 111
BstKTI GATC 3 cut(s) 29, 81, 133
BstMBI GATC 3 cut(s) 26, 78, 130
BstMCI CGRYCG 1 cut(s) 81
BstMWI GCNNNNNNNGC 1 cut(s) 108
BstUI CGCG 2 cut(s) 109, 111
BsuRI GGCC 1 cut(s) 319
BtsCI GGATG 1 cut(s) 17
Cac8I GCNNGC 1 cut(s) 68
CfoI GCGC 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 318
CseI GACGC 1 cut(s) 23
CviJI RGCY 6 cut(s) 70, 102, 147, 218, 297, 319
CviKI_1 RGCY 6 cut(s) 70, 102, 147, 218, 297, 319
DpnI GATC 3 cut(s) 28, 80, 132
DpnII GATC 3 cut(s) 26, 78, 130
Eco130I CCWWGG 1 cut(s) 21
Eco57I CTGAAG 1 cut(s) 244
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaiI YATR 1 cut(s) 161
FaqI GGGAC 1 cut(s) 202
FokI GGATG 1 cut(s) 4
FspBI CTAG 2 cut(s) 90, 270
GlaI GCGC 1 cut(s) 110
HaeIII GGCC 1 cut(s) 319
HgaI GACGC 1 cut(s) 23
HhaI GCGC 1 cut(s) 111
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
HincII GTYRAC 1 cut(s) 181
HindII GTYRAC 1 cut(s) 181
HindIII AAGCTT 2 cut(s) 216, 295
HinfI GANTC 1 cut(s) 266
HpaI GTTAAC 1 cut(s) 181
Hpy166II GTNNAC 2 cut(s) 181, 275
Hpy188III TCNNGA 2 cut(s) 43, 90
Hpy8I GTNNAC 2 cut(s) 181, 275
Hpy99I CGWCG 2 cut(s) 17, 305
HpyF10VI GCNNNNNNNGC 1 cut(s) 108
HspAI GCGC 1 cut(s) 109
KspAI GTTAAC 1 cut(s) 181
Kzo9I GATC 3 cut(s) 26, 78, 130
LmnI GCTCC 1 cut(s) 99
LpnPI CCDG 3 cut(s) 177, 296, 301
LweI GCATC 1 cut(s) 26
MaeI CTAG 2 cut(s) 90, 270
MalI GATC 3 cut(s) 28, 80, 132
MboI GATC 3 cut(s) 26, 78, 130
MfeI CAATTG 1 cut(s) 248
MluCI AATT 3 cut(s) 59, 242, 248
MnlI CCTC 1 cut(s) 111
MseI TTAA 1 cut(s) 180
MslI CAYNNNNRTG 1 cut(s) 126
MunI CAATTG 1 cut(s) 248
MvnI CGCG 2 cut(s) 109, 111
MwoI GCNNNNNNNGC 1 cut(s) 108
NdeII GATC 3 cut(s) 26, 78, 130
NlaIV GGNNCC 1 cut(s) 101
PfeI GAWTC 1 cut(s) 266
Ple19I CGATCG 1 cut(s) 81
PspN4I GGNNCC 1 cut(s) 101
PspPI GGNCC 1 cut(s) 318
PvuI CGATCG 1 cut(s) 81
RseI CAYNNNNRTG 1 cut(s) 126
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 3 cut(s) 26, 78, 130
Sau96I GGNCC 1 cut(s) 318
SetI ASST 6 cut(s) 149, 196, 220, 226, 299, 315
SfaNI GCATC 1 cut(s) 26
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 3 cut(s) 59, 242, 248
SspMI CTAG 2 cut(s) 90, 270
StyI CCWWGG 1 cut(s) 21
TaqI TCGA 2 cut(s) 81, 300
TasI AATT 3 cut(s) 59, 242, 248
TfiI GAWTC 1 cut(s) 266
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
XapI RAATTY 1 cut(s) 242
XbaI TCTAGA 1 cut(s) 89
XspI CTAG 2 cut(s) 90, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.