Rh7DG364900

Belongs to the peptidase A1 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
48858627 .. 48858899
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG364900.1

Sequence Viewer

Length: 177 bp
ATGAGGCTCTACGATGATCTCCTTACCAACGGGTACTACACGACGTGGCTGTGGATTGGGACACCACCTCAGATTGTGGCTCTGATTGTGGATACAGGGAGTACAGTCACTTATGTGCCTTGCTCTAACTGTGAAGCGTGCAGTAACCACCACGTTCAGCTTCATTTCCAAGCTTGA

Protein Analysis

58

Amino Acids

6.56

Weight (kDa)

5.16

Isoelectric Point (pI)

11.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TAXi_N PF14543 13 - 50 6.2e-08 Xylanase inhibitor N-terminal
Asp PF00026 13 - 51 4.1e-07 Eukaryotic aspartyl protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 45
AfaI GTAC 2 cut(s) 35, 103
AjiI CACGTC 1 cut(s) 45
AleI CACNNNNGTG 1 cut(s) 113
AluBI AGCT 2 cut(s) 160, 173
AluI AGCT 2 cut(s) 160, 173
BciVI GTATCC 1 cut(s) 85
BfuI GTATCC 1 cut(s) 85
BmgBI CACGTC 1 cut(s) 45
BseMII CTCAG 1 cut(s) 83
BsgI GTGCAG 1 cut(s) 160
BslFI GGGAC 1 cut(s) 73
BsmFI GGGAC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 16
BspCNI CTCAG 1 cut(s) 82
BssMI GATC 1 cut(s) 16
Bst4CI ACNGT 2 cut(s) 106, 131
BstC8I GCNNGC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
BsuI GTATCC 1 cut(s) 85
BtrI CACGTC 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 139
Csp6I GTAC 2 cut(s) 34, 102
CviJI RGCY 5 cut(s) 7, 49, 80, 160, 173
CviKI_1 RGCY 5 cut(s) 7, 49, 80, 160, 173
CviQI GTAC 2 cut(s) 34, 102
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
DraIII CACNNNGTG 1 cut(s) 45
FaiI YATR 1 cut(s) 114
FaqI GGGAC 1 cut(s) 73
HindIII AAGCTT 1 cut(s) 171
Hpy188I TCNGA 2 cut(s) 72, 84
Hpy99I CGWCG 1 cut(s) 46
HpyCH4III ACNGT 2 cut(s) 106, 131
HpyCH4IV ACGT 2 cut(s) 44, 153
HpyCH4V TGCA 1 cut(s) 141
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 2 cut(s) 44, 153
Kzo9I GATC 1 cut(s) 16
LpnPI CCDG 1 cut(s) 81
MaeII ACGT 2 cut(s) 44, 153
MaeIII GTNAC 2 cut(s) 106, 143
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MnlI CCTC 1 cut(s) 78
MslI CAYNNNNRTG 1 cut(s) 113
NdeII GATC 1 cut(s) 16
NmuCI GTSAC 1 cut(s) 106
OliI CACNNNNGTG 1 cut(s) 113
RsaI GTAC 2 cut(s) 35, 103
RsaNI GTAC 2 cut(s) 34, 102
RseI CAYNNNNRTG 1 cut(s) 113
Sau3AI GATC 1 cut(s) 16
SetI ASST 5 cut(s) 47, 70, 156, 162, 175
SgeI CNNG 7 cut(s) 43, 52, 57, 108, 132, 150, 164
SmiMI CAYNNNNRTG 1 cut(s) 113
TaaI ACNGT 2 cut(s) 106, 131
TaiI ACGT 2 cut(s) 47, 156
TatI WGTACW 1 cut(s) 101
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.