Rroxscaffold_3G00240740

Plant calmodulin-binding domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
32556320 .. 32556790
471 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00240740.1

Sequence Viewer

Length: 471 bp
ATGGTGAAATTGCAAGCTCCAAGTCCTCTTAAAGCAAAGCCATCTAATAAGGAAATGGAGGAAAATGATTTCAAGCAGATGTTGTATGATGACAATGAAAAGCCTGCTCAACAAGAAGTGGGGAGCAATTTCTTTGTTGAAATATTTGCTAAAAGGAAGGAAGATGATGCTCAGACATTTGTTGAGGATATACCTGAAGCAGAAATCATAGATTCCTTTAATGAAGAGGAGCAAAAAGAAGATGTGGCGGATAAAGAATATCAACCTCCTTTGGATCAAGAAGAACCTGCCATGAGAAGCTGTTTGAGTGAGAGTGACTCTGATGGACTTTCGAGCATTGAAGTAGATTATGCCAATTCTGAAGCAACTGACATGGAGTGGGGAGGAAGGGCAATGATGATGATGATGAATCTAGTTCAAATGCTGGGTTTTCATCAATTCAAGATGGTGATATGCATGAAGAACCCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

156

Amino Acids

17.92

Weight (kDa)

4.22

Isoelectric Point (pI)

63.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 295
AciI CCGC 1 cut(s) 248
AclWI GGATC 1 cut(s) 282
AcuI CTGAAG 2 cut(s) 216, 381
AgsI TTSAA 5 cut(s) 73, 140, 341, 419, 442
AluBI AGCT 2 cut(s) 17, 300
AluI AGCT 2 cut(s) 17, 300
AlwI GGATC 1 cut(s) 282
AsuHPI GGTGA 2 cut(s) 16, 460
BccI CCATC 3 cut(s) 49, 317, 439
BfaI CTAG 1 cut(s) 413
BfuAI ACCTGC 1 cut(s) 295
BmsI GCATC 1 cut(s) 157
BplI GAGNNNNNCTC 2 cut(s) 302, 334
Bse3DI GCAATG 1 cut(s) 399
BseMI GCAATG 1 cut(s) 399
BseMII CTCAG 1 cut(s) 185
BseRI GAGGAG 1 cut(s) 242
BseYI CCCAGC 1 cut(s) 424
Bsp143I GATC 1 cut(s) 274
BspACI CCGC 1 cut(s) 248
BspCNI CTCAG 1 cut(s) 184
BspMI ACCTGC 1 cut(s) 295
BspPI GGATC 1 cut(s) 282
BsrDI GCAATG 1 cut(s) 399
BssMI GATC 1 cut(s) 274
Bst6I CTCTTC 1 cut(s) 219
BstC8I GCNNGC 2 cut(s) 15, 105
BstDEI CTNAG 1 cut(s) 171
BstKTI GATC 1 cut(s) 277
BstMBI GATC 1 cut(s) 274
BveI ACCTGC 1 cut(s) 295
Cac8I GCNNGC 2 cut(s) 15, 105
CviAII CATG 3 cut(s) 292, 373, 457
CviJI RGCY 4 cut(s) 17, 40, 103, 300
CviKI_1 RGCY 4 cut(s) 17, 40, 103, 300
DdeI CTNAG 1 cut(s) 171
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
Eam1104I CTCTTC 1 cut(s) 219
EarI CTCTTC 1 cut(s) 219
EciI GGCGGA 1 cut(s) 263
Eco57I CTGAAG 2 cut(s) 216, 381
EcoT22I ATGCAT 1 cut(s) 458
FaeI CATG 3 cut(s) 295, 376, 460
FaiI YATR 8 cut(s) 87, 191, 209, 293, 351, 374, 454, 458
FatI CATG 3 cut(s) 291, 372, 456
FspBI CTAG 1 cut(s) 413
GsaI CCCAGC 1 cut(s) 428
Hin1II CATG 3 cut(s) 295, 376, 460
HinfI GANTC 3 cut(s) 212, 317, 409
HphI GGTGA 2 cut(s) 16, 460
Hpy188I TCNGA 3 cut(s) 174, 322, 361
Hpy188III TCNNGA 2 cut(s) 278, 442
HpyAV CCTTC 2 cut(s) 151, 381
HpyCH4V TGCA 2 cut(s) 13, 456
HpyF3I CTNAG 1 cut(s) 171
Hsp92II CATG 3 cut(s) 295, 376, 460
Kzo9I GATC 1 cut(s) 274
LmnI GCTCC 3 cut(s) 22, 123, 229
LpnPI CCDG 4 cut(s) 117, 207, 300, 410
LweI GCATC 1 cut(s) 157
MaeI CTAG 1 cut(s) 413
MaeIII GTNAC 1 cut(s) 314
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 4 cut(s) 173, 236, 251, 293
MluCI AATT 4 cut(s) 8, 127, 355, 437
MlyI GAGTC 1 cut(s) 311
MnlI CCTC 6 cut(s) 36, 52, 178, 220, 276, 377
Mph1103I ATGCAT 1 cut(s) 458
MseI TTAA 2 cut(s) 30, 219
NdeII GATC 1 cut(s) 274
NlaIII CATG 3 cut(s) 295, 376, 460
NmuCI GTSAC 1 cut(s) 314
NsiI ATGCAT 1 cut(s) 458
PfeI GAWTC 2 cut(s) 212, 409
PleI GAGTC 1 cut(s) 311
PpsI GAGTC 1 cut(s) 311
PspFI CCCAGC 1 cut(s) 424
SaqAI TTAA 2 cut(s) 30, 219
Sau3AI GATC 1 cut(s) 274
SchI GAGTC 1 cut(s) 311
SetI ASST 5 cut(s) 19, 196, 268, 289, 302
SfaNI GCATC 1 cut(s) 157
Sse9I AATT 4 cut(s) 8, 127, 355, 437
SsiI CCGC 1 cut(s) 248
SspI AATATT 1 cut(s) 144
SspMI CTAG 1 cut(s) 413
TaqI TCGA 1 cut(s) 332
TasI AATT 4 cut(s) 8, 127, 355, 437
TfiI GAWTC 2 cut(s) 212, 409
Tru1I TTAA 2 cut(s) 30, 219
Tru9I TTAA 2 cut(s) 30, 219
TseFI GTSAC 1 cut(s) 314
Tsp45I GTSAC 1 cut(s) 314
TspDTI ATGAA 4 cut(s) 111, 237, 422, 422
XspI CTAG 1 cut(s) 413
Zsp2I ATGCAT 1 cut(s) 458
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.