Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0003606

Physical Location & Seq

Genomic Coordinates Forward (+)

32556902 .. 32557810

Gene Structure 909 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00240750.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 873 bp

ATGATGGCACAAAACAGAATTTCTGGCATTGAAGAATCTGAAAGATTGAGCTATGACCAATTTTCTTACACTGAGGATCCATTTGAAGAAGACAGTGAACTATCAGAGACAGAAATAGAGATATCTTCATCTTCAATACAACAGCCAACTGAGGACCTAACAGCAACCAGTGTGGAAGTTCAAGAGAAAACCAGAGTTTTTGAAGCAGAGGATCATGAAATGGAGTCCCATCATGGAGATGTTGAAAGCCACTACACTGCTGCTTGTGAGACGAATGAAGCTTCAGATAGCCAACCAAGGAATGAATTTCAAGATGATGGAACAGCTATGTCGACAAGTAACCACATTTCCAATGCTGCTCAGGATATCAGCACAAAATATGAAGCTGAAACAAACGCAGAGAAAGAGTATTCAGAAACAGATAAAAGTGTTGTCGCTGTTGTTTCTGGAAATCAAATGGCAGAGGCACAGAAAGTTGAAGACACCAAATCCTCAGCAGATATCCAGATTTCTGATTCAGCAAAAACTATGGTTGTACATGATGAAGATGCTAGTAAGGTTGGCCAAGGTATTGTTGATGAAAACACTTTAGTTGAGAGTAAAGATGACCTGGCCAATGGGGAGTACACGGATAATGCTAAAGCTGAATATCATAGCTTCACAGAGAAGGATCATAGTGAATTTAAGAAGGAAAAGATCTCAAGTTCCAGTGAAGGTGAGGATCAGAGTGATCTAAAGCTGAAGCAAATAGATGTAGCAGAAAACAGTGACGGAGACATTGATAGAATGGAAGTGGACAACACTTCAGAGCCAGAAGCAGCAGAAACTTTCCTCATGGCCAATAGTAGCATCAGACCATCAGTCCAGGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CaM_binding

Protein Analysis

290

Amino Acids

32.05

Weight (kDa)

4.15

Isoelectric Point (pI)

46.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003606)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G38800 AT3G54570
fragaria_vesca	FvH4_5g29010 FvH4_5g29010
malus_domestica	MD00G1188700.v1.1 MD02G1294400.v1.1 MD02G1294500.v1.1 MD07G1032000.v1.1 MD07G1032600.v1.1
prunus_persica	Prupe.2G029500_v2.0.a1 Prupe.2G029500_v2.0.a1 Prupe.2G029500_v2.0.a1 Prupe.2G029500_v2.0.a1
pyrus_communis	pycom02g24790
rosa_chinensis	RchiOBHm_Chr1g0319711
rosa_laevigata	RLG00000002328 RLG00000002329 RLG00000030462
rosa_multiflora	Rmu_sc0001301.1_g000023 Rmu_sc0002539.1_g000113
rosa_roxburghii	Rroxscaffold_3G00240740 Rroxscaffold_3G00240750 Rroxscaffold_4G00328170
rosa_rugosa	Rorug01G0029600 Rorug07G0178800 Rorug07G0178900
rosa_samantha	Rh1AG041500 Rh1BG038800 Rh1CG042400 Rh1DG027200 Rh7BG311900 Rh7BG312000 Rh7CG336800
rosa_wichuraiana	Rw1G003450 Rw7G027250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	332
AclWI	GGATC	5 cut(s)	71, 84, 219, 678, 729
AcoI	YGGCCR	3 cut(s)	562, 612, 837
AcsI	RAATTY	3 cut(s)	18, 305, 680
AcuI	CTGAAG	3 cut(s)	267, 761, 789
AfaI	GTAC	2 cut(s)	537, 626
AgsI	TTSAA	8 cut(s)	32, 86, 135, 182, 203, 245, 311, 479
AhdI	GACNNNNNGTC	1 cut(s)	860
AjnI	CCWGG	2 cut(s)	609, 864
AluBI	AGCT	7 cut(s)	51, 281, 326, 386, 644, 657, 739
AluI	AGCT	7 cut(s)	51, 281, 326, 386, 644, 657, 739
Alw26I	GTCTC	3 cut(s)	101, 263, 768
AlwI	GGATC	5 cut(s)	71, 84, 219, 678, 729
AoxI	GGCC	3 cut(s)	562, 612, 837
ApeKI	GCWGC	3 cut(s)	260, 356, 818
ApoI	RAATTY	3 cut(s)	18, 305, 680
AspS9I	GGNCC	1 cut(s)	154
AsuHPI	GGTGA	1 cut(s)	728
AvaII	GGWCC	1 cut(s)	154
BalI	TGGCCA	3 cut(s)	564, 614, 839
BamHI	GGATCC	1 cut(s)	76
BbsI	GAAGAC	2 cut(s)	96, 486
BbvCI	CCTCAGC	1 cut(s)	493
BbvI	GCAGC	3 cut(s)	247, 343, 830
BccI	CCATC	3 cut(s)	237, 311, 865
BciT130I	CCWGG	2 cut(s)	611, 866
BcoDI	GTCTC	3 cut(s)	101, 263, 768
BfaI	CTAG	1 cut(s)	552
BglII	AGATCT	1 cut(s)	696
BisI	GCNGC	3 cut(s)	261, 357, 819
BlsI	GCNGC	3 cut(s)	262, 358, 820
Bme1390I	CCNGG	2 cut(s)	611, 866
Bme18I	GGWCC	1 cut(s)	154
BmeRI	GACNNNNNGTC	1 cut(s)	860
BmgT120I	GGNCC	1 cut(s)	154
BmiI	GGNNCC	1 cut(s)	78
BmrFI	CCNGG	2 cut(s)	611, 866
BmsI	GCATC	2 cut(s)	538, 858
BpiI	GAAGAC	2 cut(s)	96, 486
Bpu10I	CCTNAGC	2 cut(s)	360, 493
BpuEI	CTTGAG	1 cut(s)	685
BsaJI	CCNNGG	3 cut(s)	296, 565, 865
Bse1I	ACTGG	2 cut(s)	168, 708
BseBI	CCWGG	2 cut(s)	611, 866
BseDI	CCNNGG	3 cut(s)	296, 565, 865
BseMII	CTCAG	4 cut(s)	63, 141, 374, 507
BseNI	ACTGG	2 cut(s)	168, 708
BseXI	GCAGC	3 cut(s)	247, 343, 830
BshFI	GGCC	3 cut(s)	564, 614, 839
BslFI	GGGAC	1 cut(s)	211
BsmAI	GTCTC	3 cut(s)	101, 263, 768
BsmBI	CGTCTC	1 cut(s)	263
BsmFI	GGGAC	1 cut(s)	211
BsnI	GGCC	3 cut(s)	564, 614, 839
Bsp1407I	TGTACA	1 cut(s)	535
Bsp143I	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
BspANI	GGCC	3 cut(s)	564, 614, 839
BspCNI	CTCAG	4 cut(s)	64, 142, 373, 506
BspHI	TCATGA	1 cut(s)	214
BspLI	GGNNCC	1 cut(s)	78
BspPI	GGATC	5 cut(s)	71, 84, 219, 678, 729
BsrGI	TGTACA	1 cut(s)	535
BsrI	ACTGG	2 cut(s)	168, 708
BssECI	CCNNGG	3 cut(s)	296, 565, 865
BssMI	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
BssT1I	CCWWGG	2 cut(s)	296, 565
Bst2UI	CCWGG	2 cut(s)	611, 866
Bst4CI	ACNGT	2 cut(s)	95, 767
BstAUI	TGTACA	1 cut(s)	535
BstDEI	CTNAG	4 cut(s)	72, 150, 360, 493
BstKTI	GATC	6 cut(s)	79, 214, 673, 699, 724, 733
BstMAI	GTCTC	3 cut(s)	101, 263, 768
BstMBI	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
BstNI	CCWGG	2 cut(s)	611, 866
BstSCI	CCNGG	2 cut(s)	609, 864
BstV1I	GCAGC	3 cut(s)	247, 343, 830
BstV2I	GAAGAC	2 cut(s)	96, 486
BstX2I	RGATCY	2 cut(s)	76, 696
BstYI	RGATCY	2 cut(s)	76, 696
BsuRI	GGCC	3 cut(s)	564, 614, 839
BtsI	GCAGTG	1 cut(s)	255
BtsIMutI	CAGTG	6 cut(s)	69, 100, 175, 255, 715, 772
CciI	TCATGA	1 cut(s)	214
Cfr13I	GGNCC	1 cut(s)	154
Csp6I	GTAC	2 cut(s)	536, 625
CspCI	CAANNNNNGTGG	2 cut(s)	153, 188
CviAII	CATG	4 cut(s)	215, 233, 539, 835
CviQI	GTAC	2 cut(s)	536, 625
DdeI	CTNAG	4 cut(s)	72, 150, 360, 493
DpnI	GATC	6 cut(s)	78, 213, 672, 698, 723, 732
DpnII	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
DriI	GACNNNNNGTC	1 cut(s)	860
EaeI	YGGCCR	3 cut(s)	562, 612, 837
Eam1105I	GACNNNNNGTC	1 cut(s)	860
Eco130I	CCWWGG	2 cut(s)	296, 565
Eco32I	GATATC	3 cut(s)	123, 367, 502
Eco47I	GGWCC	1 cut(s)	154
Eco57I	CTGAAG	3 cut(s)	267, 761, 789
EcoO109I	RGGNCCY	1 cut(s)	154
EcoRII	CCWGG	2 cut(s)	609, 864
EcoRV	GATATC	3 cut(s)	123, 367, 502
EcoT14I	CCWWGG	2 cut(s)	296, 565
ErhI	CCWWGG	2 cut(s)	296, 565
Esp3I	CGTCTC	1 cut(s)	263
FaeI	CATG	4 cut(s)	218, 236, 542, 838
FaqI	GGGAC	1 cut(s)	211
FatI	CATG	4 cut(s)	214, 232, 538, 834
FblI	GTMKAC	1 cut(s)	332
Fnu4HI	GCNGC	3 cut(s)	261, 357, 819
Fsp4HI	GCNGC	3 cut(s)	261, 357, 819
FspBI	CTAG	1 cut(s)	552
GluI	GCNGC	3 cut(s)	261, 357, 819
HaeIII	GGCC	3 cut(s)	564, 614, 839
Hin1II	CATG	4 cut(s)	218, 236, 542, 838
HincII	GTYRAC	1 cut(s)	333
HindII	GTYRAC	1 cut(s)	333
HindIII	AAGCTT	1 cut(s)	279
HinfI	GANTC	3 cut(s)	35, 224, 515
HphI	GGTGA	1 cut(s)	728
Hpy166II	GTNNAC	4 cut(s)	98, 333, 627, 796
Hpy188I	TCNGA	8 cut(s)	40, 106, 286, 415, 514, 726, 808, 854
Hpy188III	TCNNGA	6 cut(s)	182, 215, 311, 362, 447, 505
Hpy8I	GTNNAC	4 cut(s)	98, 333, 627, 796
HpyAV	CCTTC	3 cut(s)	661, 682, 707
HpyCH4III	ACNGT	2 cut(s)	95, 767
HpyF3I	CTNAG	4 cut(s)	72, 150, 360, 493
Hsp92II	CATG	4 cut(s)	218, 236, 542, 838
Kzo9I	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
Lsp1109I	GCAGC	3 cut(s)	247, 343, 830
LweI	GCATC	2 cut(s)	538, 858
MaeI	CTAG	1 cut(s)	552
MaeIII	GTNAC	2 cut(s)	338, 767
MalI	GATC	6 cut(s)	78, 213, 672, 698, 723, 732
MboI	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
MboII	GAAGA	7 cut(s)	44, 98, 101, 117, 123, 491, 557
MflI	RGATCY	2 cut(s)	76, 696
MlsI	TGGCCA	3 cut(s)	564, 614, 839
MluCI	AATT	4 cut(s)	18, 59, 305, 680
MluNI	TGGCCA	3 cut(s)	564, 614, 839
MlyI	GAGTC	1 cut(s)	233
MnlI	CCTC	7 cut(s)	67, 145, 202, 457, 502, 712, 842
Mox20I	TGGCCA	3 cut(s)	564, 614, 839
MscI	TGGCCA	3 cut(s)	564, 614, 839
MseI	TTAA	1 cut(s)	684
MslI	CAYNNNNRTG	1 cut(s)	237
Msp20I	TGGCCA	3 cut(s)	564, 614, 839
MspR9I	CCNGG	2 cut(s)	611, 866
MvaI	CCWGG	2 cut(s)	611, 866
NdeII	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
NlaIII	CATG	4 cut(s)	218, 236, 542, 838
NlaIV	GGNNCC	1 cut(s)	78
NmuCI	GTSAC	1 cut(s)	767
PagI	TCATGA	1 cut(s)	214
PfeI	GAWTC	2 cut(s)	35, 515
PkrI	GCNGC	3 cut(s)	262, 358, 820
PleI	GAGTC	1 cut(s)	232
PpsI	GAGTC	1 cut(s)	232
PpuMI	RGGWCCY	1 cut(s)	154
Psp5II	RGGWCCY	1 cut(s)	154
Psp6I	CCWGG	2 cut(s)	609, 864
PspGI	CCWGG	2 cut(s)	609, 864
PspN4I	GGNNCC	1 cut(s)	78
PspPI	GGNCC	1 cut(s)	154
PspPPI	RGGWCCY	1 cut(s)	154
PsuI	RGATCY	2 cut(s)	76, 696
RsaI	GTAC	2 cut(s)	537, 626
RsaNI	GTAC	2 cut(s)	536, 625
RseI	CAYNNNNRTG	1 cut(s)	237
SalI	GTCGAC	1 cut(s)	331
SaqAI	TTAA	1 cut(s)	684
SatI	GCNGC	3 cut(s)	261, 357, 819
Sau3AI	GATC	6 cut(s)	76, 211, 670, 696, 721, 730
Sau96I	GGNCC	1 cut(s)	154
SchI	GAGTC	1 cut(s)	233
ScrFI	CCNGG	2 cut(s)	611, 866
SfaNI	GCATC	2 cut(s)	538, 858
SinI	GGWCC	1 cut(s)	154
SmiMI	CAYNNNNRTG	1 cut(s)	237
SmlI	CTYRAG	1 cut(s)	700
SmoI	CTYRAG	1 cut(s)	700
Sse9I	AATT	4 cut(s)	18, 59, 305, 680
SspMI	CTAG	1 cut(s)	552
StyD4I	CCNGG	2 cut(s)	609, 864
StyI	CCWWGG	2 cut(s)	296, 565
TaaI	ACNGT	2 cut(s)	95, 767
TaqI	TCGA	1 cut(s)	332
TasI	AATT	4 cut(s)	18, 59, 305, 680
TatI	WGTACW	2 cut(s)	535, 624
TfiI	GAWTC	2 cut(s)	35, 515
Tru1I	TTAA	1 cut(s)	684
Tru9I	TTAA	1 cut(s)	684
TscAI	CASTG	6 cut(s)	76, 100, 175, 262, 715, 772
TseFI	GTSAC	1 cut(s)	767
TseI	GCWGC	3 cut(s)	260, 356, 818
Tsp45I	GTSAC	1 cut(s)	767
TspDTI	ATGAA	7 cut(s)	117, 231, 291, 318, 396, 558, 594
TspGWI	ACGGA	2 cut(s)	644, 786
TspRI	CASTG	6 cut(s)	76, 100, 175, 262, 715, 772
VpaK11BI	GGWCC	1 cut(s)	154
XapI	RAATTY	3 cut(s)	18, 305, 680
XmiI	GTMKAC	1 cut(s)	332
XspI	CTAG	1 cut(s)	552

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.