Rroxscaffold_7G00160450

Peptidase inhibitor I9

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0002861
Physical Location & Seq
Reverse (-)
3422484 .. 3427611
5128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00160450.1

Sequence Viewer

Length: 435 bp
ATGGTTGTTCGGCACACATTTATAGAGGACCACTGCTGCATTTTCCCTCTGTTAAGTGCGATGATTTTTAAGATTCTAACTTTGTCAAATGCTGAGGAATACCAGACATATATCATCCACATGGACCATTCCCAAAAACCTGCATCTTTCTTAACACATGAGGCATGGCATCAGTCCACCTTAACATCATTAATGCGATCATCTCTTGAAGAACATGATGAGAACAAAATGCTCTTGTACTCATACAACCATGTCATGCAGGGCTTCAGTGCAAGGCTCACAGCAACTCAGCTGTCGGAATTGGAGAAATCTCCAGCTCATGTTGCCACACACCCGCAGTTATTTCTTGAGCCGCTCACAACACACAGCCCCAAGTTTCTCGGACTGAAACAGAATTCTGGCATATGGCCAGCTGCGTCTTTGGCAAAGACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Inhibitor_I9 PA Peptidase_S8

Protein Analysis

144

Amino Acids

16.42

Weight (kDa)

6.39

Isoelectric Point (pI)

47.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Inhibitor_I9 PF05922 36 - 107 1.6e-17 Peptidase inhibitor I9
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 148
AccBSI CCGCTC 1 cut(s) 355
AciI CCGC 2 cut(s) 335, 353
AcoI YGGCCR 1 cut(s) 407
AcsI RAATTY 1 cut(s) 394
AcuI CTGAAG 1 cut(s) 250
AfaI GTAC 1 cut(s) 239
AgsI TTSAA 1 cut(s) 209
AjiI CACGTC 1 cut(s) 432
AluBI AGCT 3 cut(s) 292, 317, 413
AluI AGCT 3 cut(s) 292, 317, 413
AoxI GGCC 1 cut(s) 407
ApeKI GCWGC 2 cut(s) 36, 413
ApoI RAATTY 1 cut(s) 394
AseI ATTAAT 1 cut(s) 191
AspS9I GGNCC 2 cut(s) 28, 124
AvaII GGWCC 2 cut(s) 28, 124
BalI TGGCCA 1 cut(s) 409
BbvCI CCTCAGC 1 cut(s) 93
BbvI GCAGC 2 cut(s) 23, 400
BfuAI ACCTGC 1 cut(s) 148
BisI GCNGC 3 cut(s) 37, 353, 414
BlsI GCNGC 3 cut(s) 38, 354, 415
Bme18I GGWCC 2 cut(s) 28, 124
BmgBI CACGTC 1 cut(s) 432
BmgT120I GGNCC 2 cut(s) 28, 124
BmsI GCATC 2 cut(s) 152, 178
BpmI CTGGAG 1 cut(s) 297
Bpu10I CCTNAGC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 368
BseGI GGATG 1 cut(s) 114
BseMII CTCAG 2 cut(s) 84, 302
BseXI GCAGC 2 cut(s) 23, 400
BshFI GGCC 1 cut(s) 409
BsnI GGCC 1 cut(s) 409
Bsp143I GATC 1 cut(s) 197
BspACI CCGC 2 cut(s) 335, 353
BspANI GGCC 1 cut(s) 409
BspCNI CTCAG 2 cut(s) 85, 301
BspMI ACCTGC 1 cut(s) 148
BsrBI CCGCTC 1 cut(s) 355
BssMI GATC 1 cut(s) 197
BstC8I GCNNGC 1 cut(s) 411
BstDEI CTNAG 2 cut(s) 93, 288
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 1 cut(s) 200
BstMBI GATC 1 cut(s) 197
BstMWI GCNNNNNNNGC 2 cut(s) 323, 422
BstV1I GCAGC 2 cut(s) 23, 400
BsuRI GGCC 1 cut(s) 409
BtgZI GCGATG 1 cut(s) 74
BtrI CACGTC 1 cut(s) 432
BtsCI GGATG 1 cut(s) 114
BtsI GCAGTG 1 cut(s) 31
BtsIMutI CAGTG 2 cut(s) 31, 274
BveI ACCTGC 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 411
Cfr13I GGNCC 2 cut(s) 28, 124
CseI GACGC 1 cut(s) 405
Csp6I GTAC 1 cut(s) 238
CviAII CATG 7 cut(s) 121, 158, 165, 215, 251, 256, 320
CviJI RGCY 8 cut(s) 264, 277, 292, 317, 352, 369, 409, 413
CviKI_1 RGCY 8 cut(s) 264, 277, 292, 317, 352, 369, 409, 413
CviQI GTAC 1 cut(s) 238
DdeI CTNAG 2 cut(s) 93, 288
DpnI GATC 1 cut(s) 199
DpnII GATC 1 cut(s) 197
EaeI YGGCCR 1 cut(s) 407
Eco47I GGWCC 2 cut(s) 28, 124
Eco57I CTGAAG 1 cut(s) 250
EcoRI GAATTC 1 cut(s) 394
FaeI CATG 7 cut(s) 124, 161, 168, 218, 254, 259, 323
FatI CATG 7 cut(s) 120, 157, 164, 214, 250, 255, 319
FauI CCCGC 1 cut(s) 342
FauNDI CATATG 1 cut(s) 404
Fnu4HI GCNGC 3 cut(s) 37, 353, 414
FokI GGATG 1 cut(s) 101
Fsp4HI GCNGC 3 cut(s) 37, 353, 414
GluI GCNGC 3 cut(s) 37, 353, 414
GsuI CTGGAG 1 cut(s) 297
HaeIII GGCC 1 cut(s) 409
HgaI GACGC 1 cut(s) 405
Hin1II CATG 7 cut(s) 124, 161, 168, 218, 254, 259, 323
HinfI GANTC 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 2 cut(s) 298, 383
Hpy188III TCNNGA 2 cut(s) 206, 347
Hpy8I GTNNAC 1 cut(s) 177
HpyCH4IV ACGT 1 cut(s) 431
HpyCH4V TGCA 4 cut(s) 39, 143, 259, 272
HpyF10VI GCNNNNNNNGC 2 cut(s) 323, 422
HpyF3I CTNAG 2 cut(s) 93, 288
HpySE526I ACGT 1 cut(s) 431
Hsp92II CATG 7 cut(s) 124, 161, 168, 218, 254, 259, 323
Kzo9I GATC 1 cut(s) 197
LpnPI CCDG 6 cut(s) 116, 153, 245, 327, 384, 423
Lsp1109I GCAGC 2 cut(s) 23, 400
LweI GCATC 2 cut(s) 152, 178
MaeII ACGT 1 cut(s) 431
MalI GATC 1 cut(s) 199
MbiI CCGCTC 1 cut(s) 355
MboI GATC 1 cut(s) 197
MboII GAAGA 1 cut(s) 221
MlsI TGGCCA 1 cut(s) 409
MluCI AATT 2 cut(s) 299, 394
MluNI TGGCCA 1 cut(s) 409
MmeI TCCRAC 1 cut(s) 276
MnlI CCTC 4 cut(s) 19, 57, 88, 154
Mox20I TGGCCA 1 cut(s) 409
MscI TGGCCA 1 cut(s) 409
MseI TTAA 5 cut(s) 53, 69, 152, 182, 191
MslI CAYNNNNRTG 1 cut(s) 119
Msp20I TGGCCA 1 cut(s) 409
MspA1I CMGCKG 2 cut(s) 292, 413
MwoI GCNNNNNNNGC 2 cut(s) 323, 422
NdeI CATATG 1 cut(s) 404
NdeII GATC 1 cut(s) 197
NlaIII CATG 7 cut(s) 124, 161, 168, 218, 254, 259, 323
PfeI GAWTC 1 cut(s) 73
PkrI GCNGC 3 cut(s) 38, 354, 415
PshBI ATTAAT 1 cut(s) 191
PspPI GGNCC 2 cut(s) 28, 124
PvuII CAGCTG 2 cut(s) 292, 413
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
RseI CAYNNNNRTG 1 cut(s) 119
SaqAI TTAA 5 cut(s) 53, 69, 152, 182, 191
SatI GCNGC 3 cut(s) 37, 353, 414
Sau3AI GATC 1 cut(s) 197
Sau96I GGNCC 2 cut(s) 28, 124
SetI ASST 6 cut(s) 142, 182, 294, 319, 415, 434
SfaNI GCATC 2 cut(s) 152, 178
SinI GGWCC 2 cut(s) 28, 124
SmiMI CAYNNNNRTG 1 cut(s) 119
SmlI CTYRAG 1 cut(s) 347
SmoI CTYRAG 1 cut(s) 347
Sse9I AATT 2 cut(s) 299, 394
SsiI CCGC 2 cut(s) 335, 353
TaiI ACGT 1 cut(s) 434
TasI AATT 2 cut(s) 299, 394
TatI WGTACW 1 cut(s) 237
TauI GCSGC 1 cut(s) 355
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 5 cut(s) 53, 69, 152, 182, 191
Tru9I TTAA 5 cut(s) 53, 69, 152, 182, 191
TscAI CASTG 2 cut(s) 38, 274
TseI GCWGC 2 cut(s) 36, 413
TspRI CASTG 2 cut(s) 38, 274
VpaK11BI GGWCC 2 cut(s) 28, 124
VspI ATTAAT 1 cut(s) 191
XapI RAATTY 1 cut(s) 394
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.