Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000001

Orthogroup ID

OG0002804

Physical Location & Seq

Genomic Coordinates Forward (+)

8213077 .. 8213690

Gene Structure 614 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug01G0050100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

ATGGCTAGTGCGATCAGGAAAAGTAATAATTCTAATCAAGAAGATGCTGGAGGAAGAGTTATGAGGATTCAAGGTTTGGAAAAAGGTCCAGGAGAAATTGGCTCAAAATGGAAGACTAATGCTACTAAGGCATCAGATGTTAAGTCTTCCGTCCCAACTCAGCCCAAGAAACACTCTCTTTTGAAGCATGATCCAGCGAGGAAACCTCCATTTCCAAGTTTAAATGCTCTGATATCAATGTGGCCATGCCAGTTTTGTTCTGACCCTGTCATGAATACTAGTACGTCTGATAATGATCAAACTACTGTTACTGGTAGTTCCGGCATGCCCTCTAGTGTGGAGGGTATGGCTGAAATTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0008150 GO:0008152 GO:0010181 GO:0016491 GO:0016645 GO:0016646 GO:0032553 GO:0036094 GO:0043167 GO:0043168 GO:0044424 GO:0044444 GO:0044464 GO:0048037 GO:0050662 GO:0052873 GO:0055114 GO:0097159 GO:0097367 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FMN_red

Protein Analysis

119

Amino Acids

12.7

Weight (kDa)

9.03

Isoelectric Point (pI)

32.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002804)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G27890
fragaria_vesca	FvH4_7g03210 FvH4_7g03220
malus_domestica	MD02G1284500.v1.1 MD02G1284800.v1.1 MD07G1050400.v1.1
prunus_persica	Prupe.2G038100_v2.0.a1 Prupe.2G038100_v2.0.a1 Prupe.2G038200_v2.0.a1 Prupe.2G038400_v2.0.a1 Prupe.2G038400_v2.0.a1
pyrus_communis	pycom02g24230 pycom07g03630 pycom07g03640
rosa_chinensis	RchiOBHm_Chr1g0325161 RchiOBHm_Chr1g0325181 RchiOBHm_Chr1g0325221
rosa_laevigata	RLG00000030149 RLG00000030150 RLG00000030153
rosa_multiflora	Rmu_sc0001654.1_g000012 Rmu_sc0001654.1_g000020 Rmu_sc0007742.1_g000013 Rmu_sc0007742.1_g000019 Rmu_sc0007742.1_g000022
rosa_roxburghii	Rroxscaffold_4G00324850 Rroxscaffold_4G00324860 Rroxscaffold_4G00324870
rosa_rugosa	Rorug01G0050100 Rorug01G0050200
rosa_samantha	Rh1AG066000 Rh1AG066200 Rh1BG054100 Rh1BG054200 Rh1BG054300 Rh1CG067600 Rh1DG072400
rosa_wichuraiana	Rw0G010270 Rw1G005520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	185
AcoI	YGGCCR	1 cut(s)	242
AcsI	RAATTY	1 cut(s)	354
AfaI	GTAC	1 cut(s)	283
AgsI	TTSAA	2 cut(s)	71, 184
AhlI	ACTAGT	1 cut(s)	278
AjnI	CCWGG	1 cut(s)	88
AlwI	GGATC	1 cut(s)	185
AoxI	GGCC	1 cut(s)	242
ApoI	RAATTY	1 cut(s)	354
AspS9I	GGNCC	1 cut(s)	86
AvaII	GGWCC	1 cut(s)	86
BalI	TGGCCA	1 cut(s)	244
BbsI	GAAGAC	2 cut(s)	119, 138
BciT130I	CCWGG	1 cut(s)	90
BclI	TGATCA	1 cut(s)	295
BcuI	ACTAGT	1 cut(s)	278
BfaI	CTAG	3 cut(s)	6, 279, 333
Bme1390I	CCNGG	1 cut(s)	90
Bme18I	GGWCC	1 cut(s)	86
BmgT120I	GGNCC	1 cut(s)	86
BmrFI	CCNGG	1 cut(s)	90
BmsI	GCATC	2 cut(s)	34, 140
BpiI	GAAGAC	2 cut(s)	119, 138
BplI	GAGNNNNNCTC	2 cut(s)	190, 222
BpmI	CTGGAG	1 cut(s)	69
BsaBI	GATNNNNATC	1 cut(s)	294
BsaXI	ACNNNNNCTCC	2 cut(s)	42, 72
Bse1I	ACTGG	2 cut(s)	250, 316
Bse8I	GATNNNNATC	1 cut(s)	294
BseBI	CCWGG	1 cut(s)	90
BseJI	GATNNNNATC	1 cut(s)	294
BseMII	CTCAG	1 cut(s)	173
BseNI	ACTGG	2 cut(s)	250, 316
BshFI	GGCC	1 cut(s)	244
BsiSI	CCGG	1 cut(s)	321
BslFI	GGGAC	1 cut(s)	137
BsmFI	GGGAC	1 cut(s)	137
BsnI	GGCC	1 cut(s)	244
Bsp143I	GATC	3 cut(s)	12, 190, 295
BspANI	GGCC	1 cut(s)	244
BspCNI	CTCAG	1 cut(s)	172
BspHI	TCATGA	1 cut(s)	270
BspPI	GGATC	1 cut(s)	185
BsrI	ACTGG	2 cut(s)	250, 316
BssMI	GATC	3 cut(s)	12, 190, 295
Bst2UI	CCWGG	1 cut(s)	90
Bst4CI	ACNGT	1 cut(s)	307
Bst6I	CTCTTC	1 cut(s)	49
BstC8I	GCNNGC	1 cut(s)	326
BstDEI	CTNAG	2 cut(s)	126, 159
BstKTI	GATC	3 cut(s)	15, 193, 298
BstMBI	GATC	3 cut(s)	12, 190, 295
BstMWI	GCNNNNNNNGC	1 cut(s)	128
BstNI	CCWGG	1 cut(s)	90
BstNSI	RCATGY	1 cut(s)	328
BstSCI	CCNGG	1 cut(s)	88
BstV2I	GAAGAC	2 cut(s)	119, 138
BsuRI	GGCC	1 cut(s)	244
Cac8I	GCNNGC	1 cut(s)	326
CciI	TCATGA	1 cut(s)	270
Cfr13I	GGNCC	1 cut(s)	86
Csp6I	GTAC	1 cut(s)	282
CviAII	CATG	4 cut(s)	188, 246, 271, 325
CviJI	RGCY	5 cut(s)	5, 102, 163, 244, 350
CviKI_1	RGCY	5 cut(s)	5, 102, 163, 244, 350
CviQI	GTAC	1 cut(s)	282
DdeI	CTNAG	2 cut(s)	126, 159
DpnI	GATC	3 cut(s)	14, 192, 297
DpnII	GATC	3 cut(s)	12, 190, 295
DraI	TTTAAA	1 cut(s)	222
EaeI	YGGCCR	1 cut(s)	242
Eam1104I	CTCTTC	1 cut(s)	49
EarI	CTCTTC	1 cut(s)	49
Eco32I	GATATC	1 cut(s)	234
Eco47I	GGWCC	1 cut(s)	86
EcoRII	CCWGG	1 cut(s)	88
EcoRV	GATATC	1 cut(s)	234
FaeI	CATG	4 cut(s)	191, 249, 274, 328
FaiI	YATR	6 cut(s)	62, 189, 247, 272, 326, 347
FaqI	GGGAC	1 cut(s)	137
FatI	CATG	4 cut(s)	187, 245, 270, 324
FbaI	TGATCA	1 cut(s)	295
FspBI	CTAG	3 cut(s)	6, 279, 333
GsuI	CTGGAG	1 cut(s)	69
HaeIII	GGCC	1 cut(s)	244
HapII	CCGG	1 cut(s)	321
Hin1II	CATG	4 cut(s)	191, 249, 274, 328
HinfI	GANTC	1 cut(s)	67
HpaII	CCGG	1 cut(s)	321
Hpy188I	TCNGA	4 cut(s)	136, 231, 262, 289
Hpy188III	TCNNGA	3 cut(s)	16, 38, 271
HpyCH4III	ACNGT	1 cut(s)	307
HpyCH4IV	ACGT	1 cut(s)	284
HpyF10VI	GCNNNNNNNGC	1 cut(s)	128
HpyF3I	CTNAG	2 cut(s)	126, 159
HpySE526I	ACGT	1 cut(s)	284
Hsp92II	CATG	4 cut(s)	191, 249, 274, 328
Ksp22I	TGATCA	1 cut(s)	295
Kzo9I	GATC	3 cut(s)	12, 190, 295
LpnPI	CCDG	8 cut(s)	33, 75, 102, 207, 263, 279, 297, 334
LweI	GCATC	2 cut(s)	34, 140
MaeI	CTAG	3 cut(s)	6, 279, 333
MaeII	ACGT	1 cut(s)	284
MaeIII	GTNAC	1 cut(s)	307
MalI	GATC	3 cut(s)	14, 192, 297
MboI	GATC	3 cut(s)	12, 190, 295
MboII	GAAGA	4 cut(s)	53, 66, 124, 138
MlsI	TGGCCA	1 cut(s)	244
MluCI	AATT	3 cut(s)	28, 96, 354
MluNI	TGGCCA	1 cut(s)	244
MnlI	CCTC	6 cut(s)	44, 57, 192, 216, 334, 340
Mox20I	TGGCCA	1 cut(s)	244
MscI	TGGCCA	1 cut(s)	244
MseI	TTAA	3 cut(s)	141, 221, 358
Msp20I	TGGCCA	1 cut(s)	244
MspI	CCGG	1 cut(s)	321
MspR9I	CCNGG	1 cut(s)	90
MvaI	CCWGG	1 cut(s)	90
MwoI	GCNNNNNNNGC	1 cut(s)	128
NdeII	GATC	3 cut(s)	12, 190, 295
NlaIII	CATG	4 cut(s)	191, 249, 274, 328
NspI	RCATGY	1 cut(s)	328
PaeI	GCATGC	1 cut(s)	328
PagI	TCATGA	1 cut(s)	270
PfeI	GAWTC	1 cut(s)	67
PflFI	GACNNNGTC	1 cut(s)	266
PfoI	TCCNGGA	1 cut(s)	88
Psp6I	CCWGG	1 cut(s)	88
PspGI	CCWGG	1 cut(s)	88
PspPI	GGNCC	1 cut(s)	86
PsyI	GACNNNGTC	1 cut(s)	266
RsaI	GTAC	1 cut(s)	283
RsaNI	GTAC	1 cut(s)	282
SaqAI	TTAA	3 cut(s)	141, 221, 358
Sau3AI	GATC	3 cut(s)	12, 190, 295
Sau96I	GGNCC	1 cut(s)	86
ScrFI	CCNGG	1 cut(s)	90
SetI	ASST	4 cut(s)	76, 88, 208, 287
SfaNI	GCATC	2 cut(s)	34, 140
SinI	GGWCC	1 cut(s)	86
SpeI	ACTAGT	1 cut(s)	278
SphI	GCATGC	1 cut(s)	328
Sse9I	AATT	3 cut(s)	28, 96, 354
SspMI	CTAG	3 cut(s)	6, 279, 333
StyD4I	CCNGG	1 cut(s)	88
TaaI	ACNGT	1 cut(s)	307
TaiI	ACGT	1 cut(s)	287
TasI	AATT	3 cut(s)	28, 96, 354
TfiI	GAWTC	1 cut(s)	67
Tru1I	TTAA	3 cut(s)	141, 221, 358
Tru9I	TTAA	3 cut(s)	141, 221, 358
TspDTI	ATGAA	1 cut(s)	287
TspGWI	ACGGA	1 cut(s)	139
Tth111I	GACNNNGTC	1 cut(s)	266
VpaK11BI	GGWCC	1 cut(s)	86
XapI	RAATTY	1 cut(s)	354
XceI	RCATGY	1 cut(s)	328
XspI	CTAG	3 cut(s)	6, 279, 333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.