Rorug01G0248100

Cell division control protein 14, SIN component

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0001159
Physical Location & Seq
Reverse (-)
35600402 .. 35604324
3923 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0248100.1

Sequence Viewer

Length: 837 bp
ATGAAATTCTACCACAATCCCAGCCATCTTCACTCCTTAGTCTCCTCCATCATCAAAAGCTCCAAGAGAACCCAGTTGAACAACTTCACCAGGTGCTTCACTACTCGTGTTGGGTATGAGAGTCCACGCACAAGTCGACCCATTGATTCCAGCAAGCTCCAGGAAAGTACAGAAGCTTCATATTCATCTTCTTCAAAGCTGGTGCTCTATTCCTACTGGCAGAGCTCATGCTCTTGGCGAGTTCGCTTCGCTCTAAACCTTAAAGGGCTTTCGTACGAGTACAAACCGGTGAACCTAGCGAACAGAGAGCAGTTTAATCCAGACTTTGAGCGTCTGAATCCTCTGCATTATGTTCCGGTGTTGGTTGATGGTGACACCGTGATTTCAGACTCCTATGCAATATTTCTGTATCTGGAGGAGAAGTACCCTCAGAGACCGTTATTACCTGCTGACCCTCGGCTAAAAGCTCTTAACCTCCAGGTTGCAAGCATTATCAGCTCTAGTATACAGCCTCTTCACATGCTATCAATGCTGAAGTACATTGAGGAAAAGATTGGTCCTGAAGAGAGCCTGTCATGGGCTCAATTGCATATAGAAAAAGGTTTCTGTGCACTTGAGAAGTTGCTGAAGGATTTTGCTAGCAGATTTGCCACAGGAAATGAAGTGTATATGACTGATGTGTTCTTAGCACCACAGATTGCTATAGCTACAGCAAGGTTCAATATAAACATGTCCACATTCCCCAGTTTAAGTAGGGTGAATGAATCATACAAGGGTTTACCAGAATTCCAAGCTTCATCACCGGAAAGGCAACCTGATGCTGTGCATGGGCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CDC14

Protein Analysis

278

Amino Acids

31.72

Weight (kDa)

8.62

Isoelectric Point (pI)

55.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GST_N PF02798 66 - 139 3.2e-16 Glutathione S-transferase, N-terminal domain
GST_N_3 PF13417 69 - 146 4.4e-18 Glutathione S-transferase, N-terminal domain
GST_N_2 PF13409 75 - 140 1.5e-17 Glutathione S-transferase, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 454
AccI GTMKAC 2 cut(s) 136, 505
AcsI RAATTY 2 cut(s) 5, 785
AcuI CTGAAG 3 cut(s) 554, 582, 647
AdeI CACNNNGTG 1 cut(s) 93
AfaI GTAC 5 cut(s) 169, 275, 281, 425, 539
AfiI CCNNNNNNNGG 1 cut(s) 577
AflIII ACRYGT 1 cut(s) 729
AgeI ACCGGT 1 cut(s) 286
AgsI TTSAA 3 cut(s) 79, 195, 721
AjnI CCWGG 3 cut(s) 89, 159, 477
AluBI AGCT 9 cut(s) 60, 157, 176, 199, 225, 467, 498, 707, 794
AluI AGCT 9 cut(s) 60, 157, 176, 199, 225, 467, 498, 707, 794
Alw21I GWGCWC 3 cut(s) 207, 227, 613
Alw26I GTCTC 2 cut(s) 46, 427
Alw44I GTGCAC 1 cut(s) 609
ApaLI GTGCAC 1 cut(s) 609
ApoI RAATTY 2 cut(s) 5, 785
AsiGI ACCGGT 1 cut(s) 286
Asp700I GAANNNNTTC 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 557
AsuHPI GGTGA 5 cut(s) 79, 301, 383, 769, 792
AsuNHI GCTAGC 1 cut(s) 638
AvaII GGWCC 1 cut(s) 557
BaeGI GKGCMC 1 cut(s) 613
BanII GRGCYC 2 cut(s) 227, 583
BarI GAAGNNNNNNTAC 2 cut(s) 160, 192
BauI CACGAG 1 cut(s) 105
Bbv12I GWGCWC 3 cut(s) 207, 227, 613
BccI CCATC 3 cut(s) 33, 56, 362
BciT130I CCWGG 3 cut(s) 91, 161, 479
BcoDI GTCTC 2 cut(s) 46, 427
BfaI CTAG 3 cut(s) 296, 501, 639
BfmI CTRYAG 2 cut(s) 702, 708
BfuAI ACCTGC 1 cut(s) 454
Bme1390I CCNGG 3 cut(s) 91, 161, 479
Bme18I GGWCC 1 cut(s) 557
BmgT120I GGNCC 1 cut(s) 557
BmrFI CCNGG 3 cut(s) 91, 161, 479
BmrI ACTGGG 2 cut(s) 67, 738
BmsI GCATC 1 cut(s) 808
BmtI GCTAGC 1 cut(s) 642
BmuI ACTGGG 2 cut(s) 67, 738
BpmI CTGGAG 3 cut(s) 143, 434, 461
BpuEI CTTGAG 1 cut(s) 635
BsaI GGTCTC 1 cut(s) 427
BsaJI CCNNGG 1 cut(s) 455
BsaWI WCCGGW 3 cut(s) 286, 355, 802
BsaXI ACNNNNNCTCC 2 cut(s) 407, 437
Bsc4I CCNNNNNNNGG 1 cut(s) 577
Bse118I RCCGGY 1 cut(s) 286
Bse1I ACTGG 3 cut(s) 73, 221, 744
BseBI CCWGG 3 cut(s) 91, 161, 479
BseDI CCNNGG 1 cut(s) 455
BseLI CCNNNNNNNGG 1 cut(s) 577
BseMII CTCAG 1 cut(s) 443
BseNI ACTGG 3 cut(s) 73, 221, 744
BseRI GAGGAG 2 cut(s) 34, 431
BseSI GKGCMC 1 cut(s) 613
BseYI CCCAGC 1 cut(s) 20
BshTI ACCGGT 1 cut(s) 286
BsiHKAI GWGCWC 3 cut(s) 207, 227, 613
BsiSI CCGG 3 cut(s) 287, 356, 803
BsiWI CGTACG 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 577
BsmAI GTCTC 2 cut(s) 46, 427
Bso31I GGTCTC 1 cut(s) 427
Bsp1286I GDGCHC 4 cut(s) 207, 227, 583, 613
BspCNI CTCAG 1 cut(s) 442
BspMI ACCTGC 1 cut(s) 454
BspOI GCTAGC 1 cut(s) 642
BspTNI GGTCTC 1 cut(s) 427
BsrFI RCCGGY 1 cut(s) 286
BsrI ACTGG 3 cut(s) 73, 221, 744
BssAI RCCGGY 1 cut(s) 286
BssECI CCNNGG 1 cut(s) 455
BssNAI GTATAC 1 cut(s) 506
BssSI CACGAG 1 cut(s) 105
Bst1107I GTATAC 1 cut(s) 506
Bst2BI CACGAG 1 cut(s) 105
Bst2UI CCWGG 3 cut(s) 91, 161, 479
Bst4CI ACNGT 2 cut(s) 379, 438
Bst6I CTCTTC 2 cut(s) 519, 558
BstC8I GCNNGC 3 cut(s) 155, 487, 640
BstDEI CTNAG 3 cut(s) 37, 429, 685
BstMAI GTCTC 2 cut(s) 46, 427
BstMWI GCNNNNNNNGC 2 cut(s) 495, 529
BstNI CCWGG 3 cut(s) 91, 161, 479
BstNSI RCATGY 2 cut(s) 523, 733
BstSCI CCNGG 3 cut(s) 89, 159, 477
BstSFI CTRYAG 2 cut(s) 702, 708
BstSLI GKGCMC 1 cut(s) 613
BstZ17I GTATAC 1 cut(s) 506
BveI ACCTGC 1 cut(s) 454
Cac8I GCNNGC 3 cut(s) 155, 487, 640
Cfr10I RCCGGY 1 cut(s) 286
Cfr13I GGNCC 1 cut(s) 557
CseI GACGC 1 cut(s) 320
CsiI ACCWGGT 1 cut(s) 89
Csp6I GTAC 5 cut(s) 168, 274, 280, 424, 538
CspAI ACCGGT 1 cut(s) 286
CviAII CATG 5 cut(s) 228, 520, 576, 730, 827
CviQI GTAC 5 cut(s) 168, 274, 280, 424, 538
DdeI CTNAG 3 cut(s) 37, 429, 685
DraIII CACNNNGTG 1 cut(s) 93
Eam1104I CTCTTC 2 cut(s) 519, 558
EarI CTCTTC 2 cut(s) 519, 558
Ecl136II GAGCTC 1 cut(s) 225
Eco24I GRGCYC 2 cut(s) 227, 583
Eco31I GGTCTC 1 cut(s) 427
Eco47I GGWCC 1 cut(s) 557
Eco53kI GAGCTC 1 cut(s) 225
Eco57I CTGAAG 3 cut(s) 554, 582, 647
EcoICRI GAGCTC 1 cut(s) 225
EcoRI GAATTC 1 cut(s) 785
EcoRII CCWGG 3 cut(s) 89, 159, 477
EcoT38I GRGCYC 2 cut(s) 227, 583
FaeI CATG 5 cut(s) 231, 523, 579, 733, 830
FatI CATG 5 cut(s) 227, 519, 575, 729, 826
FblI GTMKAC 2 cut(s) 136, 505
FriOI GRGCYC 2 cut(s) 227, 583
FspBI CTAG 3 cut(s) 296, 501, 639
GsaI CCCAGC 1 cut(s) 24
GsuI CTGGAG 3 cut(s) 143, 434, 461
HapII CCGG 3 cut(s) 287, 356, 803
HgaI GACGC 1 cut(s) 320
Hin1II CATG 5 cut(s) 231, 523, 579, 733, 830
HincII GTYRAC 1 cut(s) 137
HindII GTYRAC 1 cut(s) 137
HindIII AAGCTT 2 cut(s) 174, 792
HinfI GANTC 5 cut(s) 121, 146, 337, 389, 764
HpaII CCGG 3 cut(s) 287, 356, 803
HphI GGTGA 5 cut(s) 79, 301, 383, 769, 792
Hpy166II GTNNAC 7 cut(s) 125, 137, 292, 506, 611, 735, 779
Hpy188I TCNGA 3 cut(s) 336, 388, 432
Hpy188III TCNNGA 3 cut(s) 320, 413, 560
Hpy8I GTNNAC 7 cut(s) 125, 137, 292, 506, 611, 735, 779
HpyAV CCTTC 1 cut(s) 622
HpyCH4III ACNGT 2 cut(s) 379, 438
HpyCH4V TGCA 6 cut(s) 346, 398, 485, 589, 611, 826
HpyF10VI GCNNNNNNNGC 2 cut(s) 495, 529
HpyF3I CTNAG 3 cut(s) 37, 429, 685
Hsp92II CATG 5 cut(s) 231, 523, 579, 733, 830
LmnI GCTCC 2 cut(s) 65, 162
LweI GCATC 1 cut(s) 808
MabI ACCWGGT 1 cut(s) 89
MaeI CTAG 3 cut(s) 296, 501, 639
MaeIII GTNAC 1 cut(s) 371
MboII GAAGA 5 cut(s) 20, 180, 183, 506, 575
MfeI CAATTG 1 cut(s) 584
MhlI GDGCHC 4 cut(s) 207, 227, 583, 613
MluCI AATT 3 cut(s) 5, 584, 785
MlyI GAGTC 2 cut(s) 130, 383
MnlI CCTC 8 cut(s) 55, 351, 409, 438, 465, 485, 522, 538
MroXI GAANNNNTTC 1 cut(s) 83
MseI TTAA 4 cut(s) 261, 315, 471, 749
MspI CCGG 3 cut(s) 287, 356, 803
MspR9I CCNGG 3 cut(s) 91, 161, 479
MunI CAATTG 1 cut(s) 584
MvaI CCWGG 3 cut(s) 91, 161, 479
MwoI GCNNNNNNNGC 2 cut(s) 495, 529
NheI GCTAGC 1 cut(s) 638
NlaIII CATG 5 cut(s) 231, 523, 579, 733, 830
NmeAIII GCCGAG 1 cut(s) 436
NmuCI GTSAC 1 cut(s) 371
NspI RCATGY 2 cut(s) 523, 733
PciI ACATGT 1 cut(s) 729
PcsI WCGNNNNNNNCGW 1 cut(s) 133
PdmI GAANNNNTTC 1 cut(s) 83
PfeI GAWTC 3 cut(s) 146, 337, 764
Pfl23II CGTACG 1 cut(s) 273
PfoI TCCNGGA 1 cut(s) 159
PinAI ACCGGT 1 cut(s) 286
PleI GAGTC 2 cut(s) 129, 383
PpsI GAGTC 2 cut(s) 129, 383
PscI ACATGT 1 cut(s) 729
Psp124BI GAGCTC 1 cut(s) 227
Psp6I CCWGG 3 cut(s) 89, 159, 477
PspFI CCCAGC 1 cut(s) 20
PspGI CCWGG 3 cut(s) 89, 159, 477
PspLI CGTACG 1 cut(s) 273
PspPI GGNCC 1 cut(s) 557
RsaI GTAC 5 cut(s) 169, 275, 281, 425, 539
RsaNI GTAC 5 cut(s) 168, 274, 280, 424, 538
SacI GAGCTC 1 cut(s) 227
SalI GTCGAC 1 cut(s) 135
SaqAI TTAA 4 cut(s) 261, 315, 471, 749
Sau96I GGNCC 1 cut(s) 557
SchI GAGTC 2 cut(s) 130, 383
ScrFI CCNGG 3 cut(s) 91, 161, 479
SduI GDGCHC 4 cut(s) 207, 227, 583, 613
SexAI ACCWGGT 1 cut(s) 89
SfaNI GCATC 1 cut(s) 808
SfcI CTRYAG 2 cut(s) 702, 708
SinI GGWCC 1 cut(s) 557
SmlI CTYRAG 1 cut(s) 614
SmoI CTYRAG 1 cut(s) 614
Sse9I AATT 3 cut(s) 5, 584, 785
SspI AATATT 1 cut(s) 402
SspMI CTAG 3 cut(s) 296, 501, 639
SstI GAGCTC 1 cut(s) 227
StyD4I CCNGG 3 cut(s) 89, 159, 477
TaaI ACNGT 2 cut(s) 379, 438
TaqI TCGA 1 cut(s) 136
TasI AATT 3 cut(s) 5, 584, 785
TatI WGTACW 3 cut(s) 167, 279, 537
TfiI GAWTC 3 cut(s) 146, 337, 764
Tru1I TTAA 4 cut(s) 261, 315, 471, 749
Tru9I TTAA 4 cut(s) 261, 315, 471, 749
TseFI GTSAC 1 cut(s) 371
Tsp45I GTSAC 1 cut(s) 371
TspDTI ATGAA 6 cut(s) 17, 168, 174, 675, 777, 786
VneI GTGCAC 1 cut(s) 609
VpaK11BI GGWCC 1 cut(s) 557
XapI RAATTY 2 cut(s) 5, 785
XceI RCATGY 2 cut(s) 523, 733
XmiI GTMKAC 2 cut(s) 136, 505
XmnI GAANNNNTTC 1 cut(s) 83
XspI CTAG 3 cut(s) 296, 501, 639
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.