Rorug02G0473500

Belongs to the MIP aquaporin (TC 1.A.8) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0002246
Physical Location & Seq
Reverse (-)
60513084 .. 60513515
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0473500.1

Sequence Viewer

Length: 357 bp
ATGAGGTTCTTTGCCCTGGGCCACATTATGGATCGTAATAATGAGCAACTTCTCAATGGTTTTCGGGCCTCAGCATCCAGTTATACTCATCAATTATGGATTAGTAACTTGGCACAGCAATATCCAGTGTATCATGGAGTTCAACGTGTGGTAAACCAGAATGCCAGAGTTTTCTACCAACCTGGAATGTCAGCTTTCATGAATGAGGAATTTGAAGTTGCTCGGCTATATTTTGGTGAAGCATTAACTTGGGATGCAACAAACGCTCACTTGTTGGAGTGTTTTCGAGCTTCGGTGGAGTTAGAATACCAAAGGGCACAAAGAATGATGAGGCAAAGGGAACAAAGAGCAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MIP

Protein Analysis

118

Amino Acids

13.97

Weight (kDa)

7.97

Isoelectric Point (pI)

32.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 28
AclWI GGATC 1 cut(s) 39
AcsI RAATTY 1 cut(s) 209
AfiI CCNNNNNNNGG 1 cut(s) 28
AflIII ACRYGT 1 cut(s) 145
AgsI TTSAA 2 cut(s) 143, 215
AjnI CCWGG 2 cut(s) 15, 181
AluBI AGCT 2 cut(s) 194, 290
AluI AGCT 2 cut(s) 194, 290
AlwI GGATC 1 cut(s) 39
AoxI GGCC 2 cut(s) 19, 66
ApoI RAATTY 1 cut(s) 209
AspS9I GGNCC 2 cut(s) 19, 66
AsuHPI GGTGA 1 cut(s) 248
BaeGI GKGCMC 1 cut(s) 319
BbvCI CCTCAGC 1 cut(s) 70
BciT130I CCWGG 2 cut(s) 17, 183
Bme1390I CCNGG 2 cut(s) 17, 183
BmgT120I GGNCC 2 cut(s) 19, 66
BmrFI CCNGG 2 cut(s) 17, 183
BmsI GCATC 2 cut(s) 83, 244
Bpu10I CCTNAGC 1 cut(s) 70
BsaJI CCNNGG 2 cut(s) 15, 16
Bsc4I CCNNNNNNNGG 1 cut(s) 28
Bse1I ACTGG 2 cut(s) 78, 125
BseBI CCWGG 2 cut(s) 17, 183
BseDI CCNNGG 2 cut(s) 15, 16
BseGI GGATG 2 cut(s) 74, 259
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 84
BseNI ACTGG 2 cut(s) 78, 125
BseSI GKGCMC 1 cut(s) 319
BshFI GGCC 2 cut(s) 21, 68
BslI CCNNNNNNNGG 1 cut(s) 28
BsmI GAATGC 1 cut(s) 166
BsnI GGCC 2 cut(s) 21, 68
Bsp1286I GDGCHC 1 cut(s) 319
Bsp143I GATC 1 cut(s) 31
BspANI GGCC 2 cut(s) 21, 68
BspCNI CTCAG 1 cut(s) 83
BspHI TCATGA 1 cut(s) 198
BspPI GGATC 1 cut(s) 39
BsrI ACTGG 2 cut(s) 78, 125
BssECI CCNNGG 2 cut(s) 15, 16
BssMI GATC 1 cut(s) 31
Bst2UI CCWGG 2 cut(s) 17, 183
BstDEI CTNAG 1 cut(s) 70
BstF5I GGATG 2 cut(s) 74, 259
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstMWI GCNNNNNNNGC 1 cut(s) 263
BstNI CCWGG 2 cut(s) 17, 183
BstSCI CCNGG 2 cut(s) 15, 181
BstSLI GKGCMC 1 cut(s) 319
BsuRI GGCC 2 cut(s) 21, 68
BtsCI GGATG 2 cut(s) 74, 259
BtsIMutI CAGTG 1 cut(s) 132
CciI TCATGA 1 cut(s) 198
Cfr13I GGNCC 2 cut(s) 19, 66
CviAII CATG 2 cut(s) 134, 199
CviJI RGCY 5 cut(s) 21, 68, 194, 226, 290
CviKI_1 RGCY 5 cut(s) 21, 68, 194, 226, 290
DdeI CTNAG 1 cut(s) 70
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
EcoRII CCWGG 2 cut(s) 15, 181
FaeI CATG 2 cut(s) 137, 202
FaiI YATR 6 cut(s) 29, 84, 97, 135, 200, 229
FatI CATG 2 cut(s) 133, 198
FokI GGATG 2 cut(s) 61, 266
HaeIII GGCC 2 cut(s) 21, 68
Hin1II CATG 2 cut(s) 137, 202
HphI GGTGA 1 cut(s) 248
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 356
Hpy188III TCNNGA 1 cut(s) 199
Hpy8I GTNNAC 1 cut(s) 154
HpyCH4IV ACGT 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 263
HpyF3I CTNAG 1 cut(s) 70
HpySE526I ACGT 1 cut(s) 145
Hsp92II CATG 2 cut(s) 137, 202
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 8 cut(s) 2, 29, 91, 138, 168, 170, 178, 195
LweI GCATC 2 cut(s) 83, 244
MaeII ACGT 1 cut(s) 145
MaeIII GTNAC 1 cut(s) 104
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MhlI GDGCHC 1 cut(s) 319
MluCI AATT 2 cut(s) 92, 209
MmeI TCCRAC 1 cut(s) 255
MnlI CCTC 3 cut(s) 79, 199, 324
MseI TTAA 1 cut(s) 245
MspR9I CCNGG 2 cut(s) 17, 183
Mva1269I GAATGC 1 cut(s) 166
MvaI CCWGG 2 cut(s) 17, 183
MwoI GCNNNNNNNGC 1 cut(s) 263
NdeII GATC 1 cut(s) 31
NlaIII CATG 2 cut(s) 137, 202
NmeAIII GCCGAG 1 cut(s) 202
PagI TCATGA 1 cut(s) 198
PasI CCCWGGG 1 cut(s) 16
PctI GAATGC 1 cut(s) 166
PflMI CCANNNNNTGG 1 cut(s) 28
Psp6I CCWGG 2 cut(s) 15, 181
PspGI CCWGG 2 cut(s) 15, 181
PspPI GGNCC 2 cut(s) 19, 66
SaqAI TTAA 1 cut(s) 245
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 2 cut(s) 19, 66
ScrFI CCNGG 2 cut(s) 17, 183
SduI GDGCHC 1 cut(s) 319
SetI ASST 5 cut(s) 8, 148, 184, 196, 292
SfaNI GCATC 2 cut(s) 83, 244
Sse9I AATT 2 cut(s) 92, 209
StyD4I CCNGG 2 cut(s) 15, 181
TaiI ACGT 1 cut(s) 148
TaqI TCGA 1 cut(s) 286
TasI AATT 2 cut(s) 92, 209
Tru1I TTAA 1 cut(s) 245
Tru9I TTAA 1 cut(s) 245
TscAI CASTG 1 cut(s) 132
TspDTI ATGAA 2 cut(s) 187, 215
TspRI CASTG 1 cut(s) 132
Van91I CCANNNNNTGG 1 cut(s) 28
XapI RAATTY 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.