Rorug03G0304700

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
32341287 .. 32341685
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0304700.1

Sequence Viewer

Length: 198 bp
ATGGGGGGAATTCCGGTGCAGCAAGGCGACAAAGATTGTGGCATATTCATCATGCGGTACATGAAGGAAATAGTTGCGGATAAGAATCTAGAATTTGCATCAAAGTGGCAGCGGCGATCGGAATCGGTTTACACCCAAAAGGATCTTGATGATGTCAGGTCAGAGTGGGCAAAGTTTGTCTTGAAGTATCATGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.66

Weight (kDa)

7.86

Isoelectric Point (pI)

40.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 55, 77, 112
AclWI GGATC 1 cut(s) 150
AcsI RAATTY 2 cut(s) 9, 92
AfaI GTAC 1 cut(s) 59
AgsI TTSAA 1 cut(s) 184
AlwI GGATC 1 cut(s) 150
ApeKI GCWGC 2 cut(s) 19, 109
ApoI RAATTY 2 cut(s) 9, 92
BbvI GCAGC 2 cut(s) 31, 121
BfaI CTAG 1 cut(s) 89
BisI GCNGC 3 cut(s) 20, 110, 113
BlsI GCNGC 3 cut(s) 21, 111, 114
BmsI GCATC 1 cut(s) 107
BsaBI GATNNNNATC 2 cut(s) 84, 121
BsaWI WCCGGW 1 cut(s) 13
Bse8I GATNNNNATC 2 cut(s) 84, 121
BseJI GATNNNNATC 2 cut(s) 84, 121
BseXI GCAGC 2 cut(s) 31, 121
BsgI GTGCAG 1 cut(s) 38
Bsh1285I CGRYCG 1 cut(s) 119
BsiEI CGRYCG 1 cut(s) 119
BsiSI CCGG 1 cut(s) 14
Bsp143I GATC 2 cut(s) 116, 142
BspACI CCGC 3 cut(s) 55, 77, 112
BspPI GGATC 1 cut(s) 150
BssMI GATC 2 cut(s) 116, 142
BstKTI GATC 2 cut(s) 119, 145
BstMBI GATC 2 cut(s) 116, 142
BstMCI CGRYCG 1 cut(s) 119
BstV1I GCAGC 2 cut(s) 31, 121
BstX2I RGATCY 1 cut(s) 142
BstYI RGATCY 1 cut(s) 142
Csp6I GTAC 1 cut(s) 58
CspCI CAANNNNNGTGG 2 cut(s) 19, 54
CviAII CATG 3 cut(s) 52, 61, 191
CviQI GTAC 1 cut(s) 58
DpnI GATC 2 cut(s) 118, 144
DpnII GATC 2 cut(s) 116, 142
EcoRI GAATTC 1 cut(s) 9
EcoT22I ATGCAT 1 cut(s) 196
FaeI CATG 3 cut(s) 55, 64, 194
FaiI YATR 5 cut(s) 44, 53, 62, 192, 196
FalI AAGNNNNNCTT 2 cut(s) 164, 196
FatI CATG 3 cut(s) 51, 60, 190
Fnu4HI GCNGC 3 cut(s) 20, 110, 113
Fsp4HI GCNGC 3 cut(s) 20, 110, 113
FspBI CTAG 1 cut(s) 89
GluI GCNGC 3 cut(s) 20, 110, 113
HapII CCGG 1 cut(s) 14
Hin1II CATG 3 cut(s) 55, 64, 194
HinfI GANTC 2 cut(s) 85, 122
HpaII CCGG 1 cut(s) 14
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 2 cut(s) 121, 163
Hpy188III TCNNGA 3 cut(s) 89, 146, 181
Hpy8I GTNNAC 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 58
HpyCH4V TGCA 3 cut(s) 19, 98, 194
Hsp92II CATG 3 cut(s) 55, 64, 194
Kzo9I GATC 2 cut(s) 116, 142
LpnPI CCDG 2 cut(s) 27, 142
Lsp1109I GCAGC 2 cut(s) 31, 121
LweI GCATC 1 cut(s) 107
MaeI CTAG 1 cut(s) 89
MalI GATC 2 cut(s) 118, 144
MboI GATC 2 cut(s) 116, 142
MflI RGATCY 1 cut(s) 142
MluCI AATT 2 cut(s) 9, 92
Mph1103I ATGCAT 1 cut(s) 196
MslI CAYNNNNRTG 1 cut(s) 103
MspA1I CMGCKG 1 cut(s) 112
MspI CCGG 1 cut(s) 14
NdeII GATC 2 cut(s) 116, 142
NlaIII CATG 3 cut(s) 55, 64, 194
NsiI ATGCAT 1 cut(s) 196
PfeI GAWTC 2 cut(s) 85, 122
PkrI GCNGC 3 cut(s) 21, 111, 114
Ple19I CGATCG 1 cut(s) 119
PsuI RGATCY 1 cut(s) 142
PvuI CGATCG 1 cut(s) 119
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
RseI CAYNNNNRTG 1 cut(s) 103
SatI GCNGC 3 cut(s) 20, 110, 113
Sau3AI GATC 2 cut(s) 116, 142
SetI ASST 1 cut(s) 161
SfaNI GCATC 1 cut(s) 107
SgeI CNNG 8 cut(s) 26, 35, 64, 73, 101, 158, 169, 193
SmiMI CAYNNNNRTG 1 cut(s) 103
Sse9I AATT 2 cut(s) 9, 92
SsiI CCGC 3 cut(s) 55, 77, 112
SspMI CTAG 1 cut(s) 89
TasI AATT 2 cut(s) 9, 92
TauI GCSGC 1 cut(s) 115
TfiI GAWTC 2 cut(s) 85, 122
TseI GCWGC 2 cut(s) 19, 109
TspDTI ATGAA 2 cut(s) 37, 77
XapI RAATTY 2 cut(s) 9, 92
XbaI TCTAGA 1 cut(s) 88
XspI CTAG 1 cut(s) 89
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.