Rorug05G0367900

XH domain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
49188278 .. 49188795
518 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0367900.1

Sequence Viewer

Length: 207 bp
ATGTGGCCGTTGATTGTCCATGCACCGGACGACGAAGAAGAATCGACGGTGAGAAGGTCCGACTGCTCCGGCGAGTTTCAGCGAATTCCGGCGACTCCGGCCACCGATTGGCTTGCATGTGCTTCGTCGCGGTTCCTCTACGCTGGCGACTTTTCCGGCTCTTCTCAGCTTACTCCTGGCTTCGTTGCATCTGTAGAAGAAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.41

Weight (kDa)

4.21

Isoelectric Point (pI)

71.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 108
AccII CGCG 1 cut(s) 130
AciI CCGC 1 cut(s) 130
AcoI YGGCCR 2 cut(s) 5, 99
AcsI RAATTY 1 cut(s) 84
AfiI CCNNNNNNNGG 2 cut(s) 25, 108
AjnI CCWGG 1 cut(s) 175
AluBI AGCT 2 cut(s) 169, 204
AluI AGCT 2 cut(s) 169, 204
AoxI GGCC 2 cut(s) 5, 99
ApoI RAATTY 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 61
AvaII GGWCC 1 cut(s) 57
BcgI CGANNNNNNTGC 4 cut(s) 95, 105, 129, 139
BciT130I CCWGG 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 192
Bme1390I CCNGG 1 cut(s) 177
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 1 cut(s) 57
BmiI GGNNCC 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 177
BmsI GCATC 1 cut(s) 197
BsaWI WCCGGW 1 cut(s) 25
Bsc4I CCNNNNNNNGG 2 cut(s) 25, 108
BseBI CCWGG 1 cut(s) 177
BseLI CCNNNNNNNGG 2 cut(s) 25, 108
BseMII CTCAG 1 cut(s) 179
Bsh1236I CGCG 1 cut(s) 130
BshFI GGCC 2 cut(s) 7, 101
BsiSI CCGG 5 cut(s) 26, 69, 89, 98, 156
BslI CCNNNNNNNGG 2 cut(s) 25, 108
BsnI GGCC 2 cut(s) 7, 101
BspACI CCGC 1 cut(s) 130
BspANI GGCC 2 cut(s) 7, 101
BspCNI CTCAG 1 cut(s) 178
BspFNI CGCG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 134
BspQI GCTCTTC 1 cut(s) 166
Bst2UI CCWGG 1 cut(s) 177
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 166
BstC8I GCNNGC 2 cut(s) 114, 145
BstDEI CTNAG 1 cut(s) 165
BstFNI CGCG 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNI CCWGG 1 cut(s) 177
BstNSI RCATGY 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 175
BstSFI CTRYAG 1 cut(s) 192
BstUI CGCG 1 cut(s) 130
BsuRI GGCC 2 cut(s) 7, 101
Cac8I GCNNGC 2 cut(s) 114, 145
Cfr13I GGNCC 1 cut(s) 57
CviAII CATG 2 cut(s) 20, 117
CviJI RGCY 7 cut(s) 7, 101, 112, 159, 169, 180, 204
CviKI_1 RGCY 7 cut(s) 7, 101, 112, 159, 169, 180, 204
DdeI CTNAG 1 cut(s) 165
EaeI YGGCCR 2 cut(s) 5, 99
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
Eco47I GGWCC 1 cut(s) 57
EcoRI GAATTC 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 175
FaeI CATG 2 cut(s) 23, 120
FaiI YATR 2 cut(s) 21, 118
FatI CATG 2 cut(s) 19, 116
HaeIII GGCC 2 cut(s) 7, 101
HapII CCGG 5 cut(s) 26, 69, 89, 98, 156
Hin1II CATG 2 cut(s) 23, 120
HinfI GANTC 2 cut(s) 41, 94
HpaII CCGG 5 cut(s) 26, 69, 89, 98, 156
HphI GGTGA 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 61
Hpy99I CGWCG 3 cut(s) 35, 49, 130
HpyAV CCTTC 1 cut(s) 48
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 3 cut(s) 23, 116, 188
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
HpyF3I CTNAG 1 cut(s) 165
Hsp92II CATG 2 cut(s) 23, 120
LguI GCTCTTC 1 cut(s) 166
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 8 cut(s) 39, 82, 102, 111, 129, 162, 169, 189
LweI GCATC 1 cut(s) 197
MboII GAAGA 3 cut(s) 47, 50, 153
MluCI AATT 1 cut(s) 84
MlyI GAGTC 1 cut(s) 88
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 1 cut(s) 146
MspI CCGG 5 cut(s) 26, 69, 89, 98, 156
MspR9I CCNGG 1 cut(s) 177
MvaI CCWGG 1 cut(s) 177
MvnI CGCG 1 cut(s) 130
MwoI GCNNNNNNNGC 1 cut(s) 98
NlaIII CATG 2 cut(s) 23, 120
NlaIV GGNNCC 1 cut(s) 134
NspI RCATGY 1 cut(s) 120
PciSI GCTCTTC 1 cut(s) 166
PfeI GAWTC 1 cut(s) 41
PflMI CCANNNNNTGG 1 cut(s) 108
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 175
PspGI CCWGG 1 cut(s) 175
PspN4I GGNNCC 1 cut(s) 134
PspPI GGNCC 1 cut(s) 57
SapI GCTCTTC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 57
SchI GAGTC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 177
SetI ASST 3 cut(s) 59, 171, 206
SfaNI GCATC 1 cut(s) 197
SfcI CTRYAG 1 cut(s) 192
SinI GGWCC 1 cut(s) 57
Sse9I AATT 1 cut(s) 84
SsiI CCGC 1 cut(s) 130
StyD4I CCNGG 1 cut(s) 175
TaaI ACNGT 1 cut(s) 49
TaqI TCGA 1 cut(s) 44
TasI AATT 1 cut(s) 84
TfiI GAWTC 1 cut(s) 41
Van91I CCANNNNNTGG 1 cut(s) 108
VpaK11BI GGWCC 1 cut(s) 57
XapI RAATTY 1 cut(s) 84
XceI RCATGY 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.