Rorug06G0075100

heat shock protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
9996867 .. 9997196
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0075100.1

Sequence Viewer

Length: 330 bp
ATGGAGAGCAAAACCAACCAGTCTCACATTTTCCTCTTTCCGTATTTGGCTCATGGCCACATGATCCCAACACTAGACATGGCTATACTATTTGCTTCGAAAGGCATCAAGACAACCATAATTTCCACTCCCAAAAACTTGGCCTTCTTCTTCAAAACAATTGAAAGAAGCAAACCTTCGGGTTTTGATGTCGGAGTCCTCGTTCTCAAATTCCCTTCTGTAGATGTTGGATTGCCAGAAGGGTGTGAAAGTGCTCACATGGTCGAAACTCCAGAAGATGTCCAGAAGTTCTTGACAGCCACCACTTTGCTTGAGCCACAACTTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.07

Weight (kDa)

5.75

Isoelectric Point (pI)

37.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 58
AcoI YGGCCR 1 cut(s) 55
AcsI RAATTY 1 cut(s) 209
AgsI TTSAA 2 cut(s) 154, 164
AloI GAACNNNNNNTCC 2 cut(s) 186, 218
Alw21I GWGCWC 1 cut(s) 256
Alw26I GTCTC 1 cut(s) 27
AlwI GGATC 1 cut(s) 58
AoxI GGCC 2 cut(s) 55, 141
ApoI RAATTY 1 cut(s) 209
AsuII TTCGAA 1 cut(s) 98
BalI TGGCCA 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 256
BcoDI GTCTC 1 cut(s) 27
BfaI CTAG 1 cut(s) 74
BfmI CTRYAG 1 cut(s) 219
BmsI GCATC 1 cut(s) 114
BpmI CTGGAG 1 cut(s) 255
Bpu14I TTCGAA 1 cut(s) 98
BsaXI ACNNNNNCTCC 2 cut(s) 186, 216
Bse1I ACTGG 1 cut(s) 19
BseNI ACTGG 1 cut(s) 19
BshFI GGCC 2 cut(s) 57, 143
BsiHKAI GWGCWC 1 cut(s) 256
BsmAI GTCTC 1 cut(s) 27
BsnI GGCC 2 cut(s) 57, 143
Bsp119I TTCGAA 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 256
Bsp143I GATC 1 cut(s) 63
BspANI GGCC 2 cut(s) 57, 143
BspPI GGATC 1 cut(s) 58
BspT104I TTCGAA 1 cut(s) 98
BsrI ACTGG 1 cut(s) 19
BssMI GATC 1 cut(s) 63
BstBI TTCGAA 1 cut(s) 98
BstKTI GATC 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 27
BstMBI GATC 1 cut(s) 63
BstSFI CTRYAG 1 cut(s) 219
BstXI CCANNNNNNTGG 1 cut(s) 139
BsuRI GGCC 2 cut(s) 57, 143
CspCI CAANNNNNGTGG 2 cut(s) 292, 327
CviAII CATG 4 cut(s) 53, 61, 79, 259
CviJI RGCY 6 cut(s) 50, 57, 83, 143, 299, 316
CviKI_1 RGCY 6 cut(s) 50, 57, 83, 143, 299, 316
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
EaeI YGGCCR 1 cut(s) 55
FaeI CATG 4 cut(s) 56, 64, 82, 262
FaiI YATR 6 cut(s) 54, 62, 80, 86, 119, 260
FalI AAGNNNNNCTT 2 cut(s) 160, 192
FatI CATG 4 cut(s) 52, 60, 78, 258
FspBI CTAG 1 cut(s) 74
GsuI CTGGAG 1 cut(s) 255
HaeIII GGCC 2 cut(s) 57, 143
Hin1II CATG 4 cut(s) 56, 64, 82, 262
HinfI GANTC 1 cut(s) 195
Hpy188I TCNGA 1 cut(s) 194
Hpy188III TCNNGA 4 cut(s) 109, 272, 283, 292
HpyAV CCTTC 4 cut(s) 154, 186, 225, 233
Hsp92II CATG 4 cut(s) 56, 64, 82, 262
Kzo9I GATC 1 cut(s) 63
LpnPI CCDG 4 cut(s) 32, 249, 285, 296
LweI GCATC 1 cut(s) 114
MaeI CTAG 1 cut(s) 74
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MboII GAAGA 3 cut(s) 139, 142, 287
MfeI CAATTG 1 cut(s) 159
MhlI GDGCHC 1 cut(s) 256
MlsI TGGCCA 1 cut(s) 57
MluCI AATT 3 cut(s) 120, 159, 209
MluNI TGGCCA 1 cut(s) 57
MlyI GAGTC 1 cut(s) 204
MmeI TCCRAC 2 cut(s) 172, 208
MnlI CCTC 2 cut(s) 44, 209
Mox20I TGGCCA 1 cut(s) 57
MscI TGGCCA 1 cut(s) 57
Msp20I TGGCCA 1 cut(s) 57
MunI CAATTG 1 cut(s) 159
NdeII GATC 1 cut(s) 63
NlaIII CATG 4 cut(s) 56, 64, 82, 262
NspV TTCGAA 1 cut(s) 98
PcsI WCGNNNNNNNCGW 1 cut(s) 198
PleI GAGTC 1 cut(s) 203
PpsI GAGTC 1 cut(s) 203
Sau3AI GATC 1 cut(s) 63
SchI GAGTC 1 cut(s) 204
SduI GDGCHC 1 cut(s) 256
SetI ASST 1 cut(s) 178
SfaNI GCATC 1 cut(s) 114
SfcI CTRYAG 1 cut(s) 219
SfuI TTCGAA 1 cut(s) 98
SmlI CTYRAG 2 cut(s) 311, 323
SmoI CTYRAG 2 cut(s) 311, 323
Sse9I AATT 3 cut(s) 120, 159, 209
SspMI CTAG 1 cut(s) 74
TaqI TCGA 2 cut(s) 98, 264
TasI AATT 3 cut(s) 120, 159, 209
TspGWI ACGGA 1 cut(s) 30
XapI RAATTY 1 cut(s) 209
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.