Rh1BG194500

RING-type E3 ubiquitin transferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
31120726 .. 31121038
313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG194500.1

Sequence Viewer

Length: 216 bp
ATGTCGTCTTACTCCAAAGGCAAAATCTTCGTCCTCATCCACTGCCTCTCCCTCTGCAAATCCCTCAACGAAAACACCGTCGCCGTCTCCGGCTGGCTGGTCCTCCTCGACTCCGCCGTCGAGGACCTCCCCGATCTCCGCAAAAAAATCGCCGATCTCTCCAGAGACATGAAGCAAGCTCAATTCAAAGTAAGTGAAGTAATCCAAGCTCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.9

Weight (kDa)

7.78

Isoelectric Point (pI)

33.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 116
AciI CCGC 2 cut(s) 114, 139
AgsI TTSAA 1 cut(s) 187
AluBI AGCT 2 cut(s) 179, 209
AluI AGCT 2 cut(s) 179, 209
Alw26I GTCTC 2 cut(s) 91, 159
ArsI GACNNNNNNTTYG 4 cut(s) 15, 47, 63, 95
AspS9I GGNCC 2 cut(s) 100, 124
AvaII GGWCC 2 cut(s) 100, 124
BceAI ACGGC 2 cut(s) 68, 101
BcgI CGANNNNNNTGC 4 cut(s) 10, 44, 130, 164
BcoDI GTCTC 2 cut(s) 91, 159
Bme18I GGWCC 2 cut(s) 100, 124
BmgT120I GGNCC 2 cut(s) 100, 124
BpmI CTGGAG 1 cut(s) 145
BsaXI ACNNNNNCTCC 2 cut(s) 32, 62
BseGI GGATG 1 cut(s) 36
BseRI GAGGAG 1 cut(s) 95
BsiSI CCGG 1 cut(s) 90
BsmAI GTCTC 2 cut(s) 91, 159
BsmBI CGTCTC 1 cut(s) 91
Bsp143I GATC 2 cut(s) 133, 154
BspACI CCGC 2 cut(s) 114, 139
BssMI GATC 2 cut(s) 133, 154
Bst4CI ACNGT 1 cut(s) 79
BstC8I GCNNGC 2 cut(s) 95, 177
BstF5I GGATG 1 cut(s) 36
BstKTI GATC 2 cut(s) 136, 157
BstMAI GTCTC 2 cut(s) 91, 159
BstMBI GATC 2 cut(s) 133, 154
BtsCI GGATG 1 cut(s) 36
BtsI GCAGTG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 40
Cac8I GCNNGC 2 cut(s) 95, 177
Cfr13I GGNCC 2 cut(s) 100, 124
CviAII CATG 1 cut(s) 169
CviJI RGCY 4 cut(s) 93, 97, 179, 209
CviKI_1 RGCY 4 cut(s) 93, 97, 179, 209
DpnI GATC 2 cut(s) 135, 156
DpnII GATC 2 cut(s) 133, 154
DrdI GACNNNNNNGTC 1 cut(s) 116
DseDI GACNNNNNNGTC 1 cut(s) 116
EciI GGCGGA 1 cut(s) 103
Eco47I GGWCC 2 cut(s) 100, 124
EcoO109I RGGNCCY 1 cut(s) 124
Esp3I CGTCTC 1 cut(s) 91
FaeI CATG 1 cut(s) 172
FaiI YATR 1 cut(s) 170
FatI CATG 1 cut(s) 168
FokI GGATG 1 cut(s) 23
GsuI CTGGAG 1 cut(s) 145
HapII CCGG 1 cut(s) 90
Hin1II CATG 1 cut(s) 172
HinfI GANTC 1 cut(s) 110
HpaII CCGG 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 162
Hpy99I CGWCG 2 cut(s) 83, 122
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 57
Hsp92II CATG 1 cut(s) 172
Kzo9I GATC 2 cut(s) 133, 154
LpnPI CCDG 4 cut(s) 79, 83, 103, 175
MalI GATC 2 cut(s) 135, 156
MboI GATC 2 cut(s) 133, 154
MboII GAAGA 1 cut(s) 19
MluCI AATT 1 cut(s) 182
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 8 cut(s) 44, 56, 62, 74, 113, 115, 116, 137
MspI CCGG 1 cut(s) 90
NdeII GATC 2 cut(s) 133, 154
NlaIII CATG 1 cut(s) 172
PcsI WCGNNNNNNNCGW 2 cut(s) 75, 114
PleI GAGTC 1 cut(s) 104
PpsI GAGTC 1 cut(s) 104
PpuMI RGGWCCY 1 cut(s) 124
Psp5II RGGWCCY 1 cut(s) 124
PspPI GGNCC 2 cut(s) 100, 124
PspPPI RGGWCCY 1 cut(s) 124
Sau3AI GATC 2 cut(s) 133, 154
Sau96I GGNCC 2 cut(s) 100, 124
SchI GAGTC 1 cut(s) 104
SetI ASST 3 cut(s) 129, 181, 211
SgeI CNNG 9 cut(s) 102, 106, 110, 119, 133, 143, 174, 181, 188
SinI GGWCC 2 cut(s) 100, 124
Sse9I AATT 1 cut(s) 182
SsiI CCGC 2 cut(s) 114, 139
TaaI ACNGT 1 cut(s) 79
TaqI TCGA 2 cut(s) 108, 120
TasI AATT 1 cut(s) 182
TscAI CASTG 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 185
TspRI CASTG 1 cut(s) 47
VpaK11BI GGWCC 2 cut(s) 100, 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.