Rh1BG339200

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
47373572 .. 47373799
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG339200.1

Sequence Viewer

Length: 228 bp
ATGGAAAGCTCCGAAGAGCAAAGGCGGGTCCCTCTGGCCCAGGTCCTATCAGACTGCTCCAAACGGCGGTTTCAGAACACGCTCAAGGAAGCCAAGGGTGGTGACTTCGCAATGCAGGTTTTGGTGGGCCAGATGTATCATAATGGCTATGATGTTCAGAAAAACCCAGAAAATGGACATGCTTGGATGAGTAGAGCTTCAAGAGTCGAAGATCGGTTTGGAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.63

Weight (kDa)

8.93

Isoelectric Point (pI)

62.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 106
AccB7I CCANNNNNTGG 1 cut(s) 173
AciI CCGC 2 cut(s) 25, 67
AfiI CCNNNNNNNGG 2 cut(s) 66, 173
AgsI TTSAA 1 cut(s) 201
AjnI CCWGG 1 cut(s) 39
AjuI GAANNNNNNNTTGG 1 cut(s) 201
AluBI AGCT 2 cut(s) 9, 197
AluI AGCT 2 cut(s) 9, 197
AoxI GGCC 2 cut(s) 36, 127
AspS9I GGNCC 4 cut(s) 28, 37, 43, 127
AsuHPI GGTGA 1 cut(s) 113
AvaII GGWCC 2 cut(s) 28, 43
BceAI ACGGC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 41
BfuAI ACCTGC 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 41
Bme18I GGWCC 2 cut(s) 28, 43
BmgT120I GGNCC 4 cut(s) 28, 37, 43, 127
BmiI GGNNCC 2 cut(s) 29, 30
BmrFI CCNGG 1 cut(s) 41
BpuEI CTTGAG 1 cut(s) 68
BsaJI CCNNGG 2 cut(s) 39, 93
Bsc4I CCNNNNNNNGG 2 cut(s) 66, 173
Bse3DI GCAATG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 41
BseDI CCNNGG 2 cut(s) 39, 93
BseGI GGATG 1 cut(s) 192
BseLI CCNNNNNNNGG 2 cut(s) 66, 173
BseMI GCAATG 1 cut(s) 117
BshFI GGCC 2 cut(s) 38, 129
BslFI GGGAC 1 cut(s) 14
BslI CCNNNNNNNGG 2 cut(s) 66, 173
BsmFI GGGAC 1 cut(s) 14
BsnI GGCC 2 cut(s) 38, 129
Bsp143I GATC 1 cut(s) 211
BspACI CCGC 2 cut(s) 25, 67
BspANI GGCC 2 cut(s) 38, 129
BspLI GGNNCC 2 cut(s) 29, 30
BspMI ACCTGC 1 cut(s) 106
BspQI GCTCTTC 1 cut(s) 9
BsrDI GCAATG 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 39, 93
BssMI GATC 1 cut(s) 211
BssT1I CCWWGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 41
Bst6I CTCTTC 1 cut(s) 9
BstF5I GGATG 1 cut(s) 192
BstKTI GATC 1 cut(s) 214
BstMBI GATC 1 cut(s) 211
BstNI CCWGG 1 cut(s) 41
BstNSI RCATGY 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 39
BsuRI GGCC 2 cut(s) 38, 129
BtsCI GGATG 1 cut(s) 192
BveI ACCTGC 1 cut(s) 106
Cfr13I GGNCC 4 cut(s) 28, 37, 43, 127
CviAII CATG 1 cut(s) 179
CviJI RGCY 6 cut(s) 9, 38, 92, 129, 147, 197
CviKI_1 RGCY 6 cut(s) 9, 38, 92, 129, 147, 197
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eam1104I CTCTTC 1 cut(s) 9
EarI CTCTTC 1 cut(s) 9
Eco130I CCWWGG 1 cut(s) 93
Eco47I GGWCC 2 cut(s) 28, 43
EcoO109I RGGNCCY 2 cut(s) 28, 43
EcoRII CCWGG 1 cut(s) 39
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 1 cut(s) 182
FaiI YATR 3 cut(s) 141, 150, 180
FaqI GGGAC 1 cut(s) 14
FatI CATG 1 cut(s) 178
FauI CCCGC 1 cut(s) 18
FokI GGATG 1 cut(s) 199
HaeIII GGCC 2 cut(s) 38, 129
Hin1II CATG 1 cut(s) 182
HinfI GANTC 1 cut(s) 204
HphI GGTGA 1 cut(s) 113
Hpy188I TCNGA 4 cut(s) 13, 52, 75, 159
Hpy188III TCNNGA 1 cut(s) 201
HpyCH4V TGCA 1 cut(s) 115
Hsp92II CATG 1 cut(s) 182
KflI GGGWCCC 1 cut(s) 28
Kzo9I GATC 1 cut(s) 211
LguI GCTCTTC 1 cut(s) 9
LmnI GCTCC 2 cut(s) 14, 62
LpnPI CCDG 6 cut(s) 20, 26, 53, 101, 143, 180
MaeIII GTNAC 1 cut(s) 101
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 2 cut(s) 26, 221
MlyI GAGTC 1 cut(s) 213
MnlI CCTC 1 cut(s) 42
MspR9I CCNGG 1 cut(s) 41
MvaI CCWGG 1 cut(s) 41
NdeII GATC 1 cut(s) 211
NlaIII CATG 1 cut(s) 182
NlaIV GGNNCC 2 cut(s) 29, 30
NmuCI GTSAC 1 cut(s) 101
NspI RCATGY 1 cut(s) 182
PciSI GCTCTTC 1 cut(s) 9
PflMI CCANNNNNTGG 1 cut(s) 173
PleI GAGTC 1 cut(s) 212
PpsI GAGTC 1 cut(s) 212
PpuMI RGGWCCY 2 cut(s) 28, 43
Psp5II RGGWCCY 2 cut(s) 28, 43
Psp6I CCWGG 1 cut(s) 39
PspGI CCWGG 1 cut(s) 39
PspN4I GGNNCC 2 cut(s) 29, 30
PspPI GGNCC 4 cut(s) 28, 37, 43, 127
PspPPI RGGWCCY 2 cut(s) 28, 43
SapI GCTCTTC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 211
Sau96I GGNCC 4 cut(s) 28, 37, 43, 127
SchI GAGTC 1 cut(s) 213
ScrFI CCNGG 1 cut(s) 41
SetI ASST 4 cut(s) 11, 45, 120, 199
SinI GGWCC 2 cut(s) 28, 43
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
SsiI CCGC 2 cut(s) 25, 67
StyD4I CCNGG 1 cut(s) 39
StyI CCWWGG 1 cut(s) 93
TaqI TCGA 1 cut(s) 207
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
Van91I CCANNNNNTGG 1 cut(s) 173
VpaK11BI GGWCC 2 cut(s) 28, 43
XceI RCATGY 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.