Rh1DG370300

BEST Arabidopsis thaliana protein match is

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0003369
Physical Location & Seq
Reverse (-)
59501874 .. 59502146
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG370300.1

Sequence Viewer

Length: 273 bp
ATGACCCAAGTCCGGGTTTCGCCGTCGCAAACCATGAAAACGGGCAATATTCTCCGGGTCGATCTAGAGCGAGTTGGGCTGAAGATGGAGAGCTCCAAAGAGAAATGGAGGGCCCCTCTGGCCCAGGTCGTATCAGACTGCTCCAAACGGCAGTTTCAGGACACGCTCAAGGAACCAAGGGCGGTGACTTCGCAATGGAGGTCTTGGTGGGCCAGATGTATCACAATGGCTATGATGTTAAAAAAAACCCAGAAAATGGACATGCTTGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.49

Weight (kDa)

10.29

Isoelectric Point (pI)

43.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 256
AciI CCGC 1 cut(s) 182
AcuI CTGAAG 1 cut(s) 101
AfiI CCNNNNNNNGG 3 cut(s) 12, 13, 256
AjnI CCWGG 1 cut(s) 123
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
Alw21I GWGCWC 1 cut(s) 95
AoxI GGCC 3 cut(s) 111, 120, 210
ApaI GGGCCC 1 cut(s) 115
AspS9I GGNCC 4 cut(s) 111, 112, 121, 210
AsuC2I CCSGG 2 cut(s) 14, 56
AsuHPI GGTGA 1 cut(s) 196
BaeGI GKGCMC 1 cut(s) 115
BanII GRGCYC 2 cut(s) 95, 115
Bbv12I GWGCWC 1 cut(s) 95
BccI CCATC 1 cut(s) 79
BceAI ACGGC 2 cut(s) 7, 164
BciT130I CCWGG 1 cut(s) 125
BcnI CCSGG 2 cut(s) 14, 56
BfaI CTAG 1 cut(s) 65
BglI GCCNNNNNGGC 1 cut(s) 119
Bme1390I CCNGG 3 cut(s) 14, 56, 125
BmgT120I GGNCC 4 cut(s) 111, 112, 121, 210
BmiI GGNNCC 3 cut(s) 113, 114, 174
BmrFI CCNGG 3 cut(s) 14, 56, 125
BoxI GACNNNNGTC 1 cut(s) 8
BplI GAGNNNNNCTC 2 cut(s) 100, 132
BpuEI CTTGAG 1 cut(s) 152
BpuMI CCSGG 2 cut(s) 14, 56
BsaJI CCNNGG 2 cut(s) 123, 176
Bsc4I CCNNNNNNNGG 3 cut(s) 12, 13, 256
Bse3DI GCAATG 1 cut(s) 200
BseBI CCWGG 1 cut(s) 125
BseDI CCNNGG 2 cut(s) 123, 176
BseLI CCNNNNNNNGG 3 cut(s) 12, 13, 256
BseMI GCAATG 1 cut(s) 200
BseSI GKGCMC 1 cut(s) 115
BshFI GGCC 3 cut(s) 113, 122, 212
BsiHKAI GWGCWC 1 cut(s) 95
BsiSI CCGG 2 cut(s) 13, 55
BslI CCNNNNNNNGG 3 cut(s) 12, 13, 256
BsnI GGCC 3 cut(s) 113, 122, 212
Bsp120I GGGCCC 1 cut(s) 111
Bsp1286I GDGCHC 2 cut(s) 95, 115
Bsp143I GATC 1 cut(s) 61
BspACI CCGC 1 cut(s) 182
BspANI GGCC 3 cut(s) 113, 122, 212
BspLI GGNNCC 3 cut(s) 113, 114, 174
BsrDI GCAATG 1 cut(s) 200
BssECI CCNNGG 2 cut(s) 123, 176
BssMI GATC 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 176
Bst2UI CCWGG 1 cut(s) 125
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 2 cut(s) 76, 119
BstNI CCWGG 1 cut(s) 125
BstNSI RCATGY 1 cut(s) 265
BstPAI GACNNNNGTC 1 cut(s) 8
BstSCI CCNGG 3 cut(s) 12, 54, 123
BstSLI GKGCMC 1 cut(s) 115
BsuRI GGCC 3 cut(s) 113, 122, 212
Cfr13I GGNCC 4 cut(s) 111, 112, 121, 210
CviAII CATG 2 cut(s) 34, 262
CviJI RGCY 6 cut(s) 79, 93, 113, 122, 212, 230
CviKI_1 RGCY 6 cut(s) 79, 93, 113, 122, 212, 230
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Ecl136II GAGCTC 1 cut(s) 93
Eco130I CCWWGG 1 cut(s) 176
Eco24I GRGCYC 2 cut(s) 95, 115
Eco53kI GAGCTC 1 cut(s) 93
Eco57I CTGAAG 1 cut(s) 101
EcoICRI GAGCTC 1 cut(s) 93
EcoO109I RGGNCCY 2 cut(s) 111, 112
EcoRII CCWGG 1 cut(s) 123
EcoT14I CCWWGG 1 cut(s) 176
EcoT38I GRGCYC 2 cut(s) 95, 115
ErhI CCWWGG 1 cut(s) 176
FaeI CATG 2 cut(s) 37, 265
FaiI YATR 3 cut(s) 35, 233, 263
FatI CATG 2 cut(s) 33, 261
FriOI GRGCYC 2 cut(s) 95, 115
FspBI CTAG 1 cut(s) 65
HaeIII GGCC 3 cut(s) 113, 122, 212
HapII CCGG 2 cut(s) 13, 55
Hin1II CATG 2 cut(s) 37, 265
HpaII CCGG 2 cut(s) 13, 55
HphI GGTGA 1 cut(s) 196
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 2 cut(s) 65, 158
Hpy99I CGWCG 1 cut(s) 28
HpyF10VI GCNNNNNNNGC 2 cut(s) 76, 119
Hsp92II CATG 2 cut(s) 37, 265
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 2 cut(s) 98, 146
LpnPI CCDG 8 cut(s) 26, 68, 104, 110, 137, 143, 226, 263
MaeI CTAG 1 cut(s) 65
MaeIII GTNAC 1 cut(s) 184
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 94
MhlI GDGCHC 2 cut(s) 95, 115
MnlI CCTC 3 cut(s) 102, 126, 192
MseI TTAA 1 cut(s) 239
MspI CCGG 2 cut(s) 13, 55
MspR9I CCNGG 3 cut(s) 14, 56, 125
MvaI CCWGG 1 cut(s) 125
MwoI GCNNNNNNNGC 2 cut(s) 76, 119
NciI CCSGG 2 cut(s) 14, 56
NdeII GATC 1 cut(s) 61
NlaIII CATG 2 cut(s) 37, 265
NlaIV GGNNCC 3 cut(s) 113, 114, 174
NmuCI GTSAC 1 cut(s) 184
NspI RCATGY 1 cut(s) 265
PflMI CCANNNNNTGG 1 cut(s) 256
PshAI GACNNNNGTC 1 cut(s) 8
Psp124BI GAGCTC 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 123
PspGI CCWGG 1 cut(s) 123
PspN4I GGNNCC 3 cut(s) 113, 114, 174
PspOMI GGGCCC 1 cut(s) 111
PspPI GGNCC 4 cut(s) 111, 112, 121, 210
SacI GAGCTC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 239
Sau3AI GATC 1 cut(s) 61
Sau96I GGNCC 4 cut(s) 111, 112, 121, 210
ScrFI CCNGG 3 cut(s) 14, 56, 125
SduI GDGCHC 2 cut(s) 95, 115
SetI ASST 3 cut(s) 95, 129, 203
SfiI GGCCNNNNNGGCC 1 cut(s) 119
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
SsiI CCGC 1 cut(s) 182
SspI AATATT 1 cut(s) 49
SspMI CTAG 1 cut(s) 65
SstI GAGCTC 1 cut(s) 95
StyD4I CCNGG 3 cut(s) 12, 54, 123
StyI CCWWGG 1 cut(s) 176
TaqI TCGA 1 cut(s) 60
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
TseFI GTSAC 1 cut(s) 184
Tsp45I GTSAC 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 50
Van91I CCANNNNNTGG 1 cut(s) 256
XbaI TCTAGA 1 cut(s) 64
XceI RCATGY 1 cut(s) 265
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.