Rh2CG367300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
50012956 .. 50014163
1208 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG367300.1

Sequence Viewer

Length: 228 bp
ATGCAGGAAGTTGTAGTTATGATCACTGCCATCCAAGAAGAGATATTTCTGGAAATGGGTATTGGAAAGTTCGTTCTTCAAATGTTAAAATATAGTTTCATAGTCCCACCGTTGTCCTTCTTCAAAAAGATGAATGGTAGGTACTCGTGCGAGAAAGGGATTAATAAAGGTGATGCAGCATTGAGAACCCACCAAATAAATCTATGGTGGGATGTTTTTCCCACATCC
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.82

Weight (kDa)

7.88

Isoelectric Point (pI)

37.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 143
AgsI TTSAA 2 cut(s) 80, 124
AjuI GAANNNNNNNTTGG 2 cut(s) 45, 77
AloI GAACNNNNNNTCC 2 cut(s) 57, 89
ApeKI GCWGC 1 cut(s) 176
AseI ATTAAT 1 cut(s) 162
AsuHPI GGTGA 1 cut(s) 182
BauI CACGAG 1 cut(s) 145
BbvI GCAGC 1 cut(s) 188
BccI CCATC 1 cut(s) 38
BclI TGATCA 1 cut(s) 21
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
BmsI GCATC 1 cut(s) 163
BseGI GGATG 3 cut(s) 30, 217, 224
BseXI GCAGC 1 cut(s) 188
BslFI GGGAC 1 cut(s) 89
BsmFI GGGAC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 21
BssMI GATC 1 cut(s) 21
BssSI CACGAG 1 cut(s) 145
Bst2BI CACGAG 1 cut(s) 145
Bst4CI ACNGT 1 cut(s) 111
Bst6I CTCTTC 1 cut(s) 33
BstF5I GGATG 3 cut(s) 30, 217, 224
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstV1I GCAGC 1 cut(s) 188
BtsCI GGATG 3 cut(s) 30, 217, 224
BtsI GCAGTG 1 cut(s) 24
BtsIMutI CAGTG 1 cut(s) 24
Csp6I GTAC 1 cut(s) 142
CviQI GTAC 1 cut(s) 142
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
FaiI YATR 4 cut(s) 20, 93, 101, 205
FaqI GGGAC 1 cut(s) 89
FbaI TGATCA 1 cut(s) 21
Fnu4HI GCNGC 1 cut(s) 177
FokI GGATG 3 cut(s) 17, 211, 224
Fsp4HI GCNGC 1 cut(s) 177
GluI GCNGC 1 cut(s) 177
HphI GGTGA 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 127
HpyCH4III ACNGT 1 cut(s) 111
HpyCH4V TGCA 2 cut(s) 4, 176
Ksp22I TGATCA 1 cut(s) 21
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 1 cut(s) 35
Lsp1109I GCAGC 1 cut(s) 188
LweI GCATC 1 cut(s) 163
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 3 cut(s) 50, 68, 112
MseI TTAA 2 cut(s) 86, 162
NdeII GATC 1 cut(s) 21
PkrI GCNGC 1 cut(s) 178
PshBI ATTAAT 1 cut(s) 162
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 86, 162
SatI GCNGC 1 cut(s) 177
Sau3AI GATC 1 cut(s) 21
SetI ASST 2 cut(s) 143, 172
SfaNI GCATC 1 cut(s) 163
SgeI CNNG 6 cut(s) 17, 47, 62, 157, 159, 163
TaaI ACNGT 1 cut(s) 111
Tru1I TTAA 2 cut(s) 86, 162
Tru9I TTAA 2 cut(s) 86, 162
TscAI CASTG 1 cut(s) 31
TseI GCWGC 1 cut(s) 176
TspDTI ATGAA 2 cut(s) 88, 146
TspRI CASTG 1 cut(s) 31
VspI ATTAAT 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.