Rh3CG042000

Cysteine synthase-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
2829903 .. 2830381
479 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG042000.1

Sequence Viewer

Length: 246 bp
ATGCTCATAATTCTGCAGGTATCCAGTGAGGAATCTATCGAGACTGCTAGGCTGCTTGCCCTAAAAGAAGGTCTTTTGGTGGGGATCTCATCTGGTGCTGCAGCAGCAGTAGCAATAAAGTTGGCAAAGAAGCAGGAAAATGCTGGAAAACTAATAGTTGTCGTGTTCCCCAGTTTCGGAGAGCGGTATCTGTCTTCTCCACTTTTTGATACCATTAGGCATGAGGCAGAAAAAATGACTTTTTGA

Protein Analysis

81

Amino Acids

8.75

Weight (kDa)

6.57

Isoelectric Point (pI)

48.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 4 - 57 1.5e-09 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 7
AccBSI CCGCTC 1 cut(s) 184
AciI CCGC 1 cut(s) 184
AclWI GGATC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 176
Alw26I GTCTC 1 cut(s) 35
AlwI GGATC 1 cut(s) 92
ApeKI GCWGC 4 cut(s) 52, 98, 101, 104
BbsI GAAGAC 1 cut(s) 186
BbvI GCAGC 4 cut(s) 39, 85, 113, 116
BciVI GTATCC 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 1 cut(s) 48
BfmI CTRYAG 2 cut(s) 14, 99
BfuAI ACCTGC 1 cut(s) 7
BfuI GTATCC 1 cut(s) 31
BisI GCNGC 4 cut(s) 53, 99, 102, 105
BlsI GCNGC 4 cut(s) 54, 100, 103, 106
BmrI ACTGGG 1 cut(s) 165
BmuI ACTGGG 1 cut(s) 165
BpiI GAAGAC 1 cut(s) 186
Bsc4I CCNNNNNNNGG 1 cut(s) 176
Bse1I ACTGG 2 cut(s) 24, 171
BseLI CCNNNNNNNGG 1 cut(s) 176
BseNI ACTGG 2 cut(s) 24, 171
BseXI GCAGC 4 cut(s) 39, 85, 113, 116
BslI CCNNNNNNNGG 1 cut(s) 176
BsmAI GTCTC 1 cut(s) 35
Bsp143I GATC 1 cut(s) 84
BspACI CCGC 1 cut(s) 184
BspMAI CTGCAG 2 cut(s) 18, 103
BspMI ACCTGC 1 cut(s) 7
BspPI GGATC 1 cut(s) 92
BsrBI CCGCTC 1 cut(s) 184
BsrI ACTGG 2 cut(s) 24, 171
BssMI GATC 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 57
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 1 cut(s) 84
BstMWI GCNNNNNNNGC 2 cut(s) 104, 110
BstSFI CTRYAG 2 cut(s) 14, 99
BstV1I GCAGC 4 cut(s) 39, 85, 113, 116
BstV2I GAAGAC 1 cut(s) 186
BstX2I RGATCY 1 cut(s) 84
BstYI RGATCY 1 cut(s) 84
BsuI GTATCC 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 31
BveI ACCTGC 1 cut(s) 7
Cac8I GCNNGC 1 cut(s) 57
CviAII CATG 1 cut(s) 221
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
FaeI CATG 1 cut(s) 224
FaiI YATR 2 cut(s) 8, 222
FalI AAGNNNNNCTT 2 cut(s) 57, 89
FatI CATG 1 cut(s) 220
Fnu4HI GCNGC 4 cut(s) 53, 99, 102, 105
Fsp4HI GCNGC 4 cut(s) 53, 99, 102, 105
FspBI CTAG 1 cut(s) 48
GluI GCNGC 4 cut(s) 53, 99, 102, 105
Hin1II CATG 1 cut(s) 224
HinfI GANTC 1 cut(s) 32
Hpy188I TCNGA 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 16, 101
HpyF10VI GCNNNNNNNGC 2 cut(s) 104, 110
Hsp92II CATG 1 cut(s) 224
Kzo9I GATC 1 cut(s) 84
LpnPI CCDG 6 cut(s) 2, 37, 78, 119, 129, 184
Lsp1109I GCAGC 4 cut(s) 39, 85, 113, 116
MaeI CTAG 1 cut(s) 48
MalI GATC 1 cut(s) 86
MbiI CCGCTC 1 cut(s) 184
MboI GATC 1 cut(s) 84
MboII GAAGA 1 cut(s) 186
MflI RGATCY 1 cut(s) 84
MluCI AATT 1 cut(s) 9
MnlI CCTC 2 cut(s) 22, 217
MwoI GCNNNNNNNGC 2 cut(s) 104, 110
NdeII GATC 1 cut(s) 84
NlaIII CATG 1 cut(s) 224
PfeI GAWTC 1 cut(s) 32
PkrI GCNGC 4 cut(s) 54, 100, 103, 106
PstI CTGCAG 2 cut(s) 18, 103
PsuI RGATCY 1 cut(s) 84
SatI GCNGC 4 cut(s) 53, 99, 102, 105
Sau3AI GATC 1 cut(s) 84
SetI ASST 2 cut(s) 21, 73
SfcI CTRYAG 2 cut(s) 14, 99
Sse9I AATT 1 cut(s) 9
SsiI CCGC 1 cut(s) 184
SspMI CTAG 1 cut(s) 48
TaqI TCGA 1 cut(s) 39
TasI AATT 1 cut(s) 9
TfiI GAWTC 1 cut(s) 32
TscAI CASTG 1 cut(s) 31
TseI GCWGC 4 cut(s) 52, 98, 101, 104
TspRI CASTG 1 cut(s) 31
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.