Rh3CG261300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
25569003 .. 25569686
684 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG261300.1

Sequence Viewer

Length: 219 bp
ATGTGGGCCAATAACTTTGTATACCAAACCGACCCGGAAAGCCCAGTCCGGGTACTTTATATATGTACCAGGACGAATTATTTGGCTTCTCTCCTGCAAAATCAAATCGATTCGTTTAGGGAAATCAAAGCGACCAACCCTAGCTTCTCTCACTTCGACGCTATCTCCGGCAAAGGAACGCCGTCATCGAGCCAGTCACCGGCGATAAAATGTATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.06

Weight (kDa)

7.79

Isoelectric Point (pI)

49.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 21
AfaI GTAC 2 cut(s) 54, 67
AfiI CCNNNNNNNGG 2 cut(s) 49, 199
AjnI CCWGG 1 cut(s) 68
AjuI GAANNNNNNNTTGG 2 cut(s) 128, 160
AluBI AGCT 1 cut(s) 144
AluI AGCT 1 cut(s) 144
AoxI GGCC 1 cut(s) 6
ArsI GACNNNNNNTTYG 2 cut(s) 64, 96
AspS9I GGNCC 1 cut(s) 6
AsuC2I CCSGG 2 cut(s) 35, 50
AsuHPI GGTGA 1 cut(s) 189
BceAI ACGGC 1 cut(s) 166
BciT130I CCWGG 1 cut(s) 70
BcnI CCSGG 2 cut(s) 35, 50
BfaI CTAG 1 cut(s) 141
Bme1390I CCNGG 3 cut(s) 35, 50, 70
BmgT120I GGNCC 1 cut(s) 6
BmrFI CCNGG 3 cut(s) 35, 50, 70
BmrI ACTGGG 1 cut(s) 38
BmuI ACTGGG 1 cut(s) 38
BpuMI CCSGG 2 cut(s) 35, 50
Bsa29I ATCGAT 1 cut(s) 108
BsaXI ACNNNNNCTCC 2 cut(s) 149, 179
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 199
Bse118I RCCGGY 1 cut(s) 199
Bse1I ACTGG 2 cut(s) 44, 193
BseBI CCWGG 1 cut(s) 70
BseCI ATCGAT 1 cut(s) 108
BseLI CCNNNNNNNGG 2 cut(s) 49, 199
BseNI ACTGG 2 cut(s) 44, 193
BshFI GGCC 1 cut(s) 8
BshVI ATCGAT 1 cut(s) 108
BsiSI CCGG 4 cut(s) 35, 49, 168, 200
BslI CCNNNNNNNGG 2 cut(s) 49, 199
BsnI GGCC 1 cut(s) 8
BspANI GGCC 1 cut(s) 8
BspDI ATCGAT 1 cut(s) 108
BsrFI RCCGGY 1 cut(s) 199
BsrI ACTGG 2 cut(s) 44, 193
BssAI RCCGGY 1 cut(s) 199
BssNAI GTATAC 1 cut(s) 22
Bst1107I GTATAC 1 cut(s) 22
Bst2UI CCWGG 1 cut(s) 70
BstNI CCWGG 1 cut(s) 70
BstSCI CCNGG 3 cut(s) 33, 48, 68
BstZ17I GTATAC 1 cut(s) 22
Bsu15I ATCGAT 1 cut(s) 108
BsuRI GGCC 1 cut(s) 8
BsuTUI ATCGAT 1 cut(s) 108
Cfr10I RCCGGY 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 6
ClaI ATCGAT 1 cut(s) 108
CseI GACGC 1 cut(s) 167
Csp6I GTAC 2 cut(s) 53, 66
CviJI RGCY 5 cut(s) 8, 42, 86, 144, 192
CviKI_1 RGCY 5 cut(s) 8, 42, 86, 144, 192
CviQI GTAC 2 cut(s) 53, 66
EcoRII CCWGG 1 cut(s) 68
FaiI YATR 4 cut(s) 22, 60, 62, 64
FblI GTMKAC 1 cut(s) 21
FspBI CTAG 1 cut(s) 141
HaeIII GGCC 1 cut(s) 8
HapII CCGG 4 cut(s) 35, 49, 168, 200
HgaI GACGC 1 cut(s) 167
HinfI GANTC 1 cut(s) 110
HpaII CCGG 4 cut(s) 35, 49, 168, 200
HphI GGTGA 1 cut(s) 189
Hpy166II GTNNAC 1 cut(s) 22
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 161
HpyCH4V TGCA 1 cut(s) 97
LpnPI CCDG 9 cut(s) 48, 55, 57, 62, 82, 107, 181, 206, 213
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 195
MluCI AATT 1 cut(s) 76
MspI CCGG 4 cut(s) 35, 49, 168, 200
MspR9I CCNGG 3 cut(s) 35, 50, 70
MvaI CCWGG 1 cut(s) 70
NciI CCSGG 2 cut(s) 35, 50
NmuCI GTSAC 1 cut(s) 195
PcsI WCGNNNNNNNCGW 1 cut(s) 185
PfeI GAWTC 1 cut(s) 110
Psp6I CCWGG 1 cut(s) 68
PspGI CCWGG 1 cut(s) 68
PspPI GGNCC 1 cut(s) 6
RsaI GTAC 2 cut(s) 54, 67
RsaNI GTAC 2 cut(s) 53, 66
Sau96I GGNCC 1 cut(s) 6
ScrFI CCNGG 3 cut(s) 35, 50, 70
SetI ASST 1 cut(s) 146
SgrAI CRCCGGYG 1 cut(s) 199
Sse9I AATT 1 cut(s) 76
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 3 cut(s) 33, 48, 68
TaqI TCGA 3 cut(s) 108, 156, 188
TasI AATT 1 cut(s) 76
TfiI GAWTC 1 cut(s) 110
TseFI GTSAC 1 cut(s) 195
Tsp45I GTSAC 1 cut(s) 195
XmiI GTMKAC 1 cut(s) 21
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.