Rh4DG143300

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
28354391 .. 28357296
2906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG143300.1

Sequence Viewer

Length: 273 bp
ATGGTGTTTTTTTTCACTTCTTCAGTTGATGTGGAGAGACATGCTAGAGATTTTATGGACGCTGCCAAAAAGCTTCAGCTGCATTTTCTTGGTCTGCAACGTGAGGACCAGCCAACAAATGCTGAACAACTTAGAAAGGAGATTGCTGTGATGGAAGAGGAGTTGAATATAAAGACTGAGATCATCAAGAAGCATGAAAGGCTAATCCAGGGGTGGAAAAAGGAGCTAAAAGACCAATTGAACAAGCACAACACCGAGCTTGAGAAGGTGTAG

Protein Analysis

90

Amino Acids

10.76

Weight (kDa)

6.42

Isoelectric Point (pI)

46.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med28 PF11594 9 - 76 4.9e-18 Mediator complex subunit 28
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 6, 59
AgsI TTSAA 2 cut(s) 166, 241
AjnI CCWGG 1 cut(s) 207
AluBI AGCT 4 cut(s) 73, 79, 226, 259
AluI AGCT 4 cut(s) 73, 79, 226, 259
Alw26I GTCTC 1 cut(s) 31
ApeKI GCWGC 2 cut(s) 62, 79
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BbvI GCAGC 2 cut(s) 49, 66
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 209
BcoDI GTCTC 1 cut(s) 31
BfaI CTAG 1 cut(s) 45
BisI GCNGC 2 cut(s) 63, 80
BlsI GCNGC 2 cut(s) 64, 81
Bme1390I CCNGG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 209
BsaJI CCNNGG 1 cut(s) 208
BseBI CCWGG 1 cut(s) 209
BseDI CCNNGG 1 cut(s) 208
BseMII CTCAG 1 cut(s) 168
BseRI GAGGAG 1 cut(s) 173
BseXI GCAGC 2 cut(s) 49, 66
BsmAI GTCTC 1 cut(s) 31
Bsp143I GATC 1 cut(s) 180
BspCNI CTCAG 1 cut(s) 169
BssECI CCNNGG 1 cut(s) 208
BssMI GATC 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 209
Bst6I CTCTTC 1 cut(s) 150
BstDEI CTNAG 2 cut(s) 131, 177
BstKTI GATC 1 cut(s) 183
BstMAI GTCTC 1 cut(s) 31
BstMBI GATC 1 cut(s) 180
BstMWI GCNNNNNNNGC 2 cut(s) 79, 199
BstNI CCWGG 1 cut(s) 209
BstNSI RCATGY 1 cut(s) 44
BstSCI CCNGG 1 cut(s) 207
BstV1I GCAGC 2 cut(s) 49, 66
Cfr13I GGNCC 1 cut(s) 106
CseI GACGC 1 cut(s) 68
CviAII CATG 2 cut(s) 41, 194
CviJI RGCY 6 cut(s) 73, 79, 112, 202, 226, 259
CviKI_1 RGCY 6 cut(s) 73, 79, 112, 202, 226, 259
DdeI CTNAG 2 cut(s) 131, 177
DpnI GATC 1 cut(s) 182
DpnII GATC 1 cut(s) 180
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 106
Eco57I CTGAAG 2 cut(s) 6, 59
EcoRII CCWGG 1 cut(s) 207
FaeI CATG 2 cut(s) 44, 197
FaiI YATR 4 cut(s) 42, 56, 170, 195
FatI CATG 2 cut(s) 40, 193
Fnu4HI GCNGC 2 cut(s) 63, 80
Fsp4HI GCNGC 2 cut(s) 63, 80
FspBI CTAG 1 cut(s) 45
GluI GCNGC 2 cut(s) 63, 80
HgaI GACGC 1 cut(s) 68
Hin1II CATG 2 cut(s) 44, 197
HindIII AAGCTT 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 187
HpyAV CCTTC 1 cut(s) 259
HpyCH4IV ACGT 1 cut(s) 100
HpyCH4V TGCA 2 cut(s) 82, 97
HpyF10VI GCNNNNNNNGC 2 cut(s) 79, 199
HpyF3I CTNAG 2 cut(s) 131, 177
HpySE526I ACGT 1 cut(s) 100
Hsp92II CATG 2 cut(s) 44, 197
Kzo9I GATC 1 cut(s) 180
LmnI GCTCC 1 cut(s) 223
LpnPI CCDG 3 cut(s) 122, 194, 221
Lsp1109I GCAGC 2 cut(s) 49, 66
MaeI CTAG 1 cut(s) 45
MaeII ACGT 1 cut(s) 100
MalI GATC 1 cut(s) 182
MboI GATC 1 cut(s) 180
MboII GAAGA 2 cut(s) 12, 167
MfeI CAATTG 1 cut(s) 236
MluCI AATT 1 cut(s) 236
MnlI CCTC 2 cut(s) 97, 151
MspA1I CMGCKG 1 cut(s) 79
MspR9I CCNGG 1 cut(s) 209
MunI CAATTG 1 cut(s) 236
MvaI CCWGG 1 cut(s) 209
MwoI GCNNNNNNNGC 2 cut(s) 79, 199
NdeII GATC 1 cut(s) 180
NlaIII CATG 2 cut(s) 44, 197
NspI RCATGY 1 cut(s) 44
PkrI GCNGC 2 cut(s) 64, 81
Psp6I CCWGG 1 cut(s) 207
PspGI CCWGG 1 cut(s) 207
PspPI GGNCC 1 cut(s) 106
PvuII CAGCTG 1 cut(s) 79
SatI GCNGC 2 cut(s) 63, 80
Sau3AI GATC 1 cut(s) 180
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 209
SetI ASST 6 cut(s) 75, 81, 103, 228, 261, 270
SinI GGWCC 1 cut(s) 106
SmlI CTYRAG 1 cut(s) 260
SmoI CTYRAG 1 cut(s) 260
Sse9I AATT 1 cut(s) 236
SspMI CTAG 1 cut(s) 45
StyD4I CCNGG 1 cut(s) 207
TaiI ACGT 1 cut(s) 103
TasI AATT 1 cut(s) 236
TseI GCWGC 2 cut(s) 62, 79
TspDTI ATGAA 1 cut(s) 210
VpaK11BI GGWCC 1 cut(s) 106
XceI RCATGY 1 cut(s) 44
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.