Rh5AG121100

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
11298473 .. 11298684
212 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG121100.1

Sequence Viewer

Length: 212 bp
ATGGAAAATGCTGGAAAAATGGAAGTACATGTAGAAGAAAAGGAAGACAGCAAAACCGATTACCTGGAAACCTCAGTTCCTGCGTCTAATGGGGTGGTGAATGACTTGCCAAAAGATGCAAGCTTCACAAAGAAACAGAAAGGGATGAGATCTGTACTGATTAAACAAGAGGAACGGAAAACAGGTGTTGTAAGTTGGAAAATTTTTCAGAG

Protein Analysis

70

Amino Acids

7.93

Weight (kDa)

6.57

Isoelectric Point (pI)

44.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 201
AfaI GTAC 2 cut(s) 27, 156
AflIII ACRYGT 1 cut(s) 28
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 1 cut(s) 123
AluI AGCT 1 cut(s) 123
AlwNI CAGNNNCTG 1 cut(s) 80
ApoI RAATTY 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 109
BbsI GAAGAC 1 cut(s) 51
BciT130I CCWGG 1 cut(s) 65
BglII AGATCT 1 cut(s) 149
Bme1390I CCNGG 1 cut(s) 65
BmrFI CCNGG 1 cut(s) 65
BmsI GCATC 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 51
BseBI CCWGG 1 cut(s) 65
BseGI GGATG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 87
Bsp143I GATC 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 86
BssMI GATC 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 73
BstF5I GGATG 1 cut(s) 150
BstKTI GATC 1 cut(s) 152
BstMBI GATC 1 cut(s) 149
BstNI CCWGG 1 cut(s) 65
BstNSI RCATGY 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 63
BstV2I GAAGAC 1 cut(s) 51
BstX2I RGATCY 1 cut(s) 149
BstYI RGATCY 1 cut(s) 149
BtsCI GGATG 1 cut(s) 150
Cac8I GCNNGC 1 cut(s) 121
CaiI CAGNNNCTG 1 cut(s) 80
CseI GACGC 1 cut(s) 72
Csp6I GTAC 2 cut(s) 26, 155
CviAII CATG 1 cut(s) 29
CviJI RGCY 1 cut(s) 123
CviKI_1 RGCY 1 cut(s) 123
CviQI GTAC 2 cut(s) 26, 155
DdeI CTNAG 1 cut(s) 73
DpnI GATC 1 cut(s) 151
DpnII GATC 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 63
FaeI CATG 1 cut(s) 32
FaiI YATR 1 cut(s) 30
FatI CATG 1 cut(s) 28
FokI GGATG 1 cut(s) 157
HgaI GACGC 1 cut(s) 72
Hin1II CATG 1 cut(s) 32
HindIII AAGCTT 1 cut(s) 121
HphI GGTGA 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 210
HpyCH4V TGCA 1 cut(s) 119
HpyF3I CTNAG 1 cut(s) 73
Hsp92II CATG 1 cut(s) 32
Kzo9I GATC 1 cut(s) 149
LpnPI CCDG 4 cut(s) 50, 77, 93, 168
LweI GCATC 1 cut(s) 106
MalI GATC 1 cut(s) 151
MboI GATC 1 cut(s) 149
MboII GAAGA 2 cut(s) 47, 56
MflI RGATCY 1 cut(s) 149
MluCI AATT 1 cut(s) 201
MmeI TCCRAC 1 cut(s) 176
MnlI CCTC 2 cut(s) 82, 163
MseI TTAA 1 cut(s) 162
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
NdeII GATC 1 cut(s) 149
NlaIII CATG 1 cut(s) 32
NspI RCATGY 1 cut(s) 32
PciI ACATGT 1 cut(s) 28
PscI ACATGT 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
PstNI CAGNNNCTG 1 cut(s) 80
PsuI RGATCY 1 cut(s) 149
RsaI GTAC 2 cut(s) 27, 156
RsaNI GTAC 2 cut(s) 26, 155
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 1 cut(s) 149
ScrFI CCNGG 1 cut(s) 65
SetI ASST 4 cut(s) 66, 74, 125, 187
SfaNI GCATC 1 cut(s) 106
SgeI CNNG 9 cut(s) 24, 41, 76, 77, 92, 118, 132, 179, 195
Sse9I AATT 1 cut(s) 201
StyD4I CCNGG 1 cut(s) 63
TasI AATT 1 cut(s) 201
TatI WGTACW 2 cut(s) 25, 154
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspGWI ACGGA 1 cut(s) 190
XapI RAATTY 1 cut(s) 201
XceI RCATGY 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.