Rh5AG167300

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
18125267 .. 18125690
424 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG167300.1

Sequence Viewer

Length: 153 bp
ATGAGTTCGGCGGTGCTGAAGGAGAGAAGAAGGCCAAATGCTCTGACTGTGTCCCTTAATTTGAAGATTTACAGAGTCAGCGATAGGCTCTTCCTCTGCCTCTCCGGCCTCACCACCGATGCTCAGACTTTGTTACCTGATGGAAAAGATTGA

Protein Analysis

50

Amino Acids

5.58

Weight (kDa)

9.62

Isoelectric Point (pI)

43.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AcuI CTGAAG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 64
AoxI GGCC 2 cut(s) 32, 106
AsuHPI GGTGA 1 cut(s) 103
BccI CCATC 1 cut(s) 134
BglI GCCNNNNNGGC 1 cut(s) 105
BmsI GCATC 1 cut(s) 109
BseMII CTCAG 1 cut(s) 137
BshFI GGCC 2 cut(s) 34, 108
BsiSI CCGG 1 cut(s) 105
BslFI GGGAC 1 cut(s) 37
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 2 cut(s) 34, 108
BspACI CCGC 1 cut(s) 11
BspANI GGCC 2 cut(s) 34, 108
BspCNI CTCAG 1 cut(s) 136
BspQI GCTCTTC 1 cut(s) 95
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 123
BstMWI GCNNNNNNNGC 1 cut(s) 105
BsuRI GGCC 2 cut(s) 34, 108
CviJI RGCY 3 cut(s) 34, 88, 108
CviKI_1 RGCY 3 cut(s) 34, 88, 108
DdeI CTNAG 1 cut(s) 123
Eam1104I CTCTTC 1 cut(s) 95
EarI CTCTTC 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 38
FaqI GGGAC 1 cut(s) 37
HaeIII GGCC 2 cut(s) 34, 108
HapII CCGG 1 cut(s) 105
HinfI GANTC 1 cut(s) 75
HpaII CCGG 1 cut(s) 105
HphI GGTGA 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 45, 126
HpyAV CCTTC 2 cut(s) 13, 24
HpyCH4III ACNGT 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
HpyF3I CTNAG 1 cut(s) 123
LguI GCTCTTC 1 cut(s) 95
LpnPI CCDG 1 cut(s) 118
LweI GCATC 1 cut(s) 109
MaeIII GTNAC 1 cut(s) 132
MboII GAAGA 3 cut(s) 39, 76, 82
MluCI AATT 1 cut(s) 58
MlyI GAGTC 1 cut(s) 84
MnlI CCTC 3 cut(s) 104, 110, 119
MseI TTAA 1 cut(s) 57
MspI CCGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 105
PciSI GCTCTTC 1 cut(s) 95
PflFI GACNNNGTC 1 cut(s) 49
PleI GAGTC 1 cut(s) 83
PpsI GAGTC 1 cut(s) 83
PsyI GACNNNGTC 1 cut(s) 49
SapI GCTCTTC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 57
SchI GAGTC 1 cut(s) 84
SetI ASST 1 cut(s) 139
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 2 cut(s) 117, 149
Sse9I AATT 1 cut(s) 58
SsiI CCGC 1 cut(s) 11
TaaI ACNGT 1 cut(s) 49
TasI AATT 1 cut(s) 58
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
Tth111I GACNNNGTC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.