Rh6AG410000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
60695778 .. 60696201
424 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG410000.1

Sequence Viewer

Length: 153 bp
ATGAGTTCGGCGGTGCTGAAGGAGAGAAGAAGGCCAAATGCTCTGACTGTGTCCCTTAATTTGAAGATTTACAGAGTCAGCGATAGGTTCTTCCTCTGCCTCTCCGGCTTCACCACCGATGCTCAGACTCTGTCACCTGATGGAAAAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.62

Weight (kDa)

9.62

Isoelectric Point (pI)

48.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AcuI CTGAAG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 64
AlwNI CAGNNNCTG 1 cut(s) 130
AoxI GGCC 1 cut(s) 32
AsuHPI GGTGA 2 cut(s) 103, 126
BccI CCATC 1 cut(s) 134
BglI GCCNNNNNGGC 1 cut(s) 105
BmsI GCATC 1 cut(s) 109
BseMII CTCAG 1 cut(s) 137
BshFI GGCC 1 cut(s) 34
BsiSI CCGG 1 cut(s) 105
BslFI GGGAC 1 cut(s) 37
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 1 cut(s) 34
BspACI CCGC 1 cut(s) 11
BspANI GGCC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 136
Bst4CI ACNGT 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 123
BstMWI GCNNNNNNNGC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 34
CaiI CAGNNNCTG 1 cut(s) 130
CviJI RGCY 2 cut(s) 34, 108
CviKI_1 RGCY 2 cut(s) 34, 108
DdeI CTNAG 1 cut(s) 123
Eco57I CTGAAG 1 cut(s) 38
FaqI GGGAC 1 cut(s) 37
HaeIII GGCC 1 cut(s) 34
HapII CCGG 1 cut(s) 105
HinfI GANTC 2 cut(s) 75, 127
HpaII CCGG 1 cut(s) 105
HphI GGTGA 2 cut(s) 103, 126
Hpy188I TCNGA 2 cut(s) 45, 126
HpyAV CCTTC 2 cut(s) 13, 24
HpyCH4III ACNGT 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
HpyF3I CTNAG 1 cut(s) 123
LpnPI CCDG 1 cut(s) 118
LweI GCATC 1 cut(s) 109
MaeIII GTNAC 1 cut(s) 132
MboII GAAGA 3 cut(s) 39, 76, 82
MluCI AATT 1 cut(s) 58
MlyI GAGTC 2 cut(s) 84, 121
MnlI CCTC 2 cut(s) 104, 110
MseI TTAA 1 cut(s) 57
MspI CCGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 132
PflFI GACNNNGTC 2 cut(s) 49, 130
PleI GAGTC 2 cut(s) 83, 121
PpsI GAGTC 2 cut(s) 83, 121
PstNI CAGNNNCTG 1 cut(s) 130
PsyI GACNNNGTC 2 cut(s) 49, 130
SaqAI TTAA 1 cut(s) 57
SchI GAGTC 2 cut(s) 84, 121
SetI ASST 2 cut(s) 89, 139
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 2 cut(s) 117, 149
Sse9I AATT 1 cut(s) 58
SsiI CCGC 1 cut(s) 11
TaaI ACNGT 1 cut(s) 49
TasI AATT 1 cut(s) 58
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TseFI GTSAC 1 cut(s) 132
Tsp45I GTSAC 1 cut(s) 132
Tth111I GACNNNGTC 2 cut(s) 49, 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.