Rh5BG086900

Crooked neck-like protein 1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
7562110 .. 7562277
168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG086900.1

Sequence Viewer

Length: 168 bp
ATGGCAATCGGTCCTTACTACAAGGTCGACGCAGACCCATCGCTAGGGTACCTAACCCAAAAAGATACGGCGGTCAAGCTACCACGACCAACTAGGGTTAAGAATAAAGCACCAGCCCCTATTCAAATCACCGCCGAGCAACTCCTCCGGGAGGCTCGTGAGCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.18

Weight (kDa)

9.77

Isoelectric Point (pI)

31.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 48
AccB1I GGYRCC 1 cut(s) 48
AccBSI CCGCTC 1 cut(s) 163
AccI GTMKAC 1 cut(s) 27
AciI CCGC 3 cut(s) 71, 132, 163
AfaI GTAC 1 cut(s) 50
AfiI CCNNNNNNNGG 2 cut(s) 44, 151
AgsI TTSAA 1 cut(s) 125
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
Asp718I GGTACC 1 cut(s) 48
AspS9I GGNCC 1 cut(s) 11
AsuC2I CCSGG 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 121
AvaII GGWCC 1 cut(s) 11
BaeI ACNNNNGTAYC 2 cut(s) 57, 90
BanI GGYRCC 1 cut(s) 48
BauI CACGAG 1 cut(s) 156
BccI CCATC 1 cut(s) 46
BceAI ACGGC 1 cut(s) 84
BcgI CGANNNNNNTGC 2 cut(s) 21, 55
BcnI CCSGG 1 cut(s) 149
BfaI CTAG 2 cut(s) 44, 93
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 11
BmiI GGNNCC 1 cut(s) 50
BmrFI CCNGG 1 cut(s) 149
BpuMI CCSGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 151
BseLI CCNNNNNNNGG 2 cut(s) 44, 151
BseRI GAGGAG 1 cut(s) 134
BshNI GGYRCC 1 cut(s) 48
BsiSI CCGG 1 cut(s) 148
BslI CCNNNNNNNGG 2 cut(s) 44, 151
BspACI CCGC 3 cut(s) 71, 132, 163
BspLI GGNNCC 1 cut(s) 50
BspT107I GGYRCC 1 cut(s) 48
BsrBI CCGCTC 1 cut(s) 163
BssSI CACGAG 1 cut(s) 156
Bst2BI CACGAG 1 cut(s) 156
BstENI CCTNNNNNAGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BtgZI GCGATG 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 11
CseI GACGC 1 cut(s) 38
Csp6I GTAC 1 cut(s) 49
CviJI RGCY 3 cut(s) 79, 116, 155
CviKI_1 RGCY 3 cut(s) 79, 116, 155
CviQI GTAC 1 cut(s) 49
Eco47I GGWCC 1 cut(s) 11
EcoNI CCTNNNNNAGG 1 cut(s) 149
FblI GTMKAC 1 cut(s) 27
FspBI CTAG 2 cut(s) 44, 93
HapII CCGG 1 cut(s) 148
HgaI GACGC 1 cut(s) 38
HincII GTYRAC 1 cut(s) 28
HindII GTYRAC 1 cut(s) 28
HpaII CCGG 1 cut(s) 148
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 28
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 28
Hpy99I CGWCG 1 cut(s) 32
KpnI GGTACC 1 cut(s) 52
LpnPI CCDG 2 cut(s) 126, 161
MaeI CTAG 2 cut(s) 44, 93
MbiI CCGCTC 1 cut(s) 163
MnlI CCTC 2 cut(s) 145, 155
MseI TTAA 1 cut(s) 99
MspI CCGG 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 149
NciI CCSGG 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 50
NmeAIII GCCGAG 1 cut(s) 160
PfoI TCCNGGA 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 50
PspPI GGNCC 1 cut(s) 11
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
SalI GTCGAC 1 cut(s) 26
SaqAI TTAA 1 cut(s) 99
Sau96I GGNCC 1 cut(s) 11
ScrFI CCNGG 1 cut(s) 149
SetI ASST 3 cut(s) 27, 54, 81
SgeI CNNG 9 cut(s) 34, 56, 88, 96, 105, 125, 148, 160, 161
SinI GGWCC 1 cut(s) 11
SsiI CCGC 3 cut(s) 71, 132, 163
SspMI CTAG 2 cut(s) 44, 93
StyD4I CCNGG 1 cut(s) 147
TaqI TCGA 1 cut(s) 27
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
VpaK11BI GGWCC 1 cut(s) 11
XagI CCTNNNNNAGG 1 cut(s) 149
XmiI GTMKAC 1 cut(s) 27
XspI CTAG 2 cut(s) 44, 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.