Rh5DG010500

Belongs to the UDP-glucose GDP-mannose dehydrogenase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
735124 .. 735423
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG010500.1

Sequence Viewer

Length: 300 bp
ATGGCAGATCAGGGTCCTCTTAATGTTGTTCCTTTAGCGGTCATTCTTCCGGACCCAAATTTAGACGTTGTTCCTTTAGCAGTCATTCTTCCGGGTCAAAACATCCTTCCTCCAAATAATGTTCTTCCTCTGGATTTCGATCATATCACCAACGTATGTTGCATCGGTGCCACCCAATCCAGCGTTATGCACATGGCAGTAATAGCAGAGCGATACCCAAGACTTAACGTCGTTGTGGCAGATTTCAATCAACAACTAATCGAAGACTGGAATGAGGGGAACATAGATTTTGAAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

99

Amino Acids

10.86

Weight (kDa)

4.05

Isoelectric Point (pI)

61.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 167
AccIII TCCGGA 1 cut(s) 49
AciI CCGC 1 cut(s) 38
AcsI RAATTY 1 cut(s) 58
AgsI TTSAA 2 cut(s) 247, 293
AhdI GACNNNNNGTC 1 cut(s) 227
Aor13HI TCCGGA 1 cut(s) 49
ApoI RAATTY 1 cut(s) 58
AspS9I GGNCC 2 cut(s) 14, 52
AsuC2I CCSGG 1 cut(s) 93
AsuHPI GGTGA 1 cut(s) 139
AvaII GGWCC 2 cut(s) 14, 52
BanI GGYRCC 1 cut(s) 167
BbsI GAAGAC 1 cut(s) 270
BcnI CCSGG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 93
Bme18I GGWCC 2 cut(s) 14, 52
BmeRI GACNNNNNGTC 1 cut(s) 227
BmgT120I GGNCC 2 cut(s) 14, 52
BmiI GGNNCC 3 cut(s) 15, 54, 169
BmrFI CCNGG 1 cut(s) 93
BmsI GCATC 1 cut(s) 171
BpiI GAAGAC 1 cut(s) 270
BpuMI CCSGG 1 cut(s) 93
BsaBI GATNNNNATC 2 cut(s) 138, 246
BsaWI WCCGGW 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 272
Bse8I GATNNNNATC 2 cut(s) 138, 246
BseAI TCCGGA 1 cut(s) 49
BseGI GGATG 1 cut(s) 102
BseJI GATNNNNATC 2 cut(s) 138, 246
BseNI ACTGG 1 cut(s) 272
BshNI GGYRCC 1 cut(s) 167
BsiSI CCGG 2 cut(s) 50, 92
Bsp13I TCCGGA 1 cut(s) 49
Bsp143I GATC 2 cut(s) 7, 139
BspACI CCGC 1 cut(s) 38
BspEI TCCGGA 1 cut(s) 49
BspLI GGNNCC 3 cut(s) 15, 54, 169
BspT107I GGYRCC 1 cut(s) 167
BsrI ACTGG 1 cut(s) 272
BssMI GATC 2 cut(s) 7, 139
Bst6I CTCTTC 1 cut(s) 288
BstF5I GGATG 1 cut(s) 102
BstKTI GATC 2 cut(s) 10, 142
BstMBI GATC 2 cut(s) 7, 139
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstSCI CCNGG 1 cut(s) 91
BstV2I GAAGAC 1 cut(s) 270
BtsCI GGATG 1 cut(s) 102
Cfr13I GGNCC 2 cut(s) 14, 52
CviAII CATG 1 cut(s) 193
DpnI GATC 2 cut(s) 9, 141
DpnII GATC 2 cut(s) 7, 139
DriI GACNNNNNGTC 1 cut(s) 227
Eam1104I CTCTTC 1 cut(s) 288
Eam1105I GACNNNNNGTC 1 cut(s) 227
EarI CTCTTC 1 cut(s) 288
Eco47I GGWCC 2 cut(s) 14, 52
EcoO109I RGGNCCY 1 cut(s) 14
FaeI CATG 1 cut(s) 196
FaiI YATR 5 cut(s) 144, 157, 188, 194, 284
FatI CATG 1 cut(s) 192
FokI GGATG 1 cut(s) 89
HapII CCGG 2 cut(s) 50, 92
Hin1II CATG 1 cut(s) 196
HpaII CCGG 2 cut(s) 50, 92
HphI GGTGA 1 cut(s) 139
Hpy188III TCNNGA 2 cut(s) 50, 131
Hpy99I CGWCG 1 cut(s) 233
HpyAV CCTTC 1 cut(s) 116
HpyCH4IV ACGT 3 cut(s) 66, 153, 228
HpyCH4V TGCA 2 cut(s) 162, 190
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpySE526I ACGT 3 cut(s) 66, 153, 228
Hsp92II CATG 1 cut(s) 196
Kpn2I TCCGGA 1 cut(s) 49
Kzo9I GATC 2 cut(s) 7, 139
LpnPI CCDG 5 cut(s) 63, 105, 116, 193, 253
LweI GCATC 1 cut(s) 171
MaeII ACGT 3 cut(s) 66, 153, 228
MalI GATC 2 cut(s) 9, 141
MboI GATC 2 cut(s) 7, 139
MboII GAAGA 4 cut(s) 38, 80, 116, 275
MluCI AATT 1 cut(s) 58
MnlI CCTC 4 cut(s) 27, 120, 138, 268
MroI TCCGGA 1 cut(s) 49
MseI TTAA 2 cut(s) 21, 225
MspI CCGG 2 cut(s) 50, 92
MspR9I CCNGG 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 203
NciI CCSGG 1 cut(s) 93
NdeII GATC 2 cut(s) 7, 139
NlaIII CATG 1 cut(s) 196
NlaIV GGNNCC 3 cut(s) 15, 54, 169
PpuMI RGGWCCY 1 cut(s) 14
Psp5II RGGWCCY 1 cut(s) 14
PspN4I GGNNCC 3 cut(s) 15, 54, 169
PspPI GGNCC 2 cut(s) 14, 52
PspPPI RGGWCCY 1 cut(s) 14
SaqAI TTAA 2 cut(s) 21, 225
Sau3AI GATC 2 cut(s) 7, 139
Sau96I GGNCC 2 cut(s) 14, 52
ScrFI CCNGG 1 cut(s) 93
SetI ASST 3 cut(s) 69, 156, 231
SfaNI GCATC 1 cut(s) 171
SgeI CNNG 9 cut(s) 23, 62, 104, 105, 143, 192, 205, 231, 280
SinI GGWCC 2 cut(s) 14, 52
Sse9I AATT 1 cut(s) 58
SsiI CCGC 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 91
TaiI ACGT 3 cut(s) 69, 156, 231
TaqI TCGA 2 cut(s) 138, 261
TasI AATT 1 cut(s) 58
Tru1I TTAA 2 cut(s) 21, 225
Tru9I TTAA 2 cut(s) 21, 225
VpaK11BI GGWCC 2 cut(s) 14, 52
XapI RAATTY 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.