Rh6CG384000

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0008988
Physical Location & Seq
Reverse (-)
57085951 .. 57086367
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG384000.1

Sequence Viewer

Length: 417 bp
ATGGCGGTGGCATCGATCAAAGAGGTTGAAATCCGGCCATTGTTTGAGCGTCTGTTCAAGAGAGTTGAGAAAGCAATGCAGAGTTCTACCGAGTTCGAATCCGTCATCGGAAATTTCAAGTCCACGCTTGACCCTCTCCAACCATGGATCAAAGGAGAACGTAAGGGACTTGAGGACCTCGTGGACAAAGAATGTCTAGTTGACAGGGGCATAAAGGTAGTAGGCAAGTTCTCCAACATTCAGATATGGAAGTACTACTGGCGTAGATATGATTACACAGACCAACTTGTTCAGTTGGACATACAATTTAAACAACTAATAGATTTTCTGATGACAAAGGACTTCGAAACTCGTGATTGGCGGCAACAAATCCAACTGGTAGATGAAATGGACAGGACAGGAGACACTCCCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
NB-ARC RPW8

Protein Analysis

138

Amino Acids

16.51

Weight (kDa)

5.31

Isoelectric Point (pI)

24.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPW8 PF05659 15 - 131 5.3e-08 Arabidopsis broad-spectrum mildew resistance protein RPW8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 361
AclWI GGATC 1 cut(s) 155
AcoI YGGCCR 1 cut(s) 35
AcsI RAATTY 1 cut(s) 112
AfaI GTAC 1 cut(s) 254
AgsI TTSAA 3 cut(s) 29, 58, 118
Alw26I GTCTC 1 cut(s) 396
AlwI GGATC 1 cut(s) 155
AoxI GGCC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 175
AsuII TTCGAA 2 cut(s) 96, 345
AvaII GGWCC 1 cut(s) 175
BauI CACGAG 2 cut(s) 179, 351
BcoDI GTCTC 1 cut(s) 396
BfaI CTAG 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 413
BisI GCNGC 1 cut(s) 362
BlsI GCNGC 1 cut(s) 363
BmcAI AGTACT 1 cut(s) 254
Bme18I GGWCC 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 175
BmsI GCATC 1 cut(s) 20
Bpu14I TTCGAA 2 cut(s) 96, 345
BpuEI CTTGAG 1 cut(s) 191
Bsa29I ATCGAT 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 143
Bse1I ACTGG 2 cut(s) 263, 381
Bse3DI GCAATG 1 cut(s) 81
BseCI ATCGAT 1 cut(s) 14
BseDI CCNNGG 1 cut(s) 143
BseMI GCAATG 1 cut(s) 81
BseNI ACTGG 2 cut(s) 263, 381
BshFI GGCC 1 cut(s) 37
BshVI ATCGAT 1 cut(s) 14
BsiSI CCGG 1 cut(s) 34
BslFI GGGAC 1 cut(s) 180
BsmAI GTCTC 1 cut(s) 396
BsmFI GGGAC 1 cut(s) 180
BsnI GGCC 1 cut(s) 37
Bsp119I TTCGAA 2 cut(s) 96, 345
Bsp143I GATC 2 cut(s) 15, 147
Bsp19I CCATGG 1 cut(s) 143
BspACI CCGC 2 cut(s) 5, 361
BspANI GGCC 1 cut(s) 37
BspDI ATCGAT 1 cut(s) 14
BspPI GGATC 1 cut(s) 155
BspT104I TTCGAA 2 cut(s) 96, 345
BsrDI GCAATG 1 cut(s) 81
BsrI ACTGG 2 cut(s) 263, 381
BssECI CCNNGG 1 cut(s) 143
BssMI GATC 2 cut(s) 15, 147
BssSI CACGAG 2 cut(s) 179, 351
BssT1I CCWWGG 1 cut(s) 143
Bst2BI CACGAG 2 cut(s) 179, 351
BstBI TTCGAA 2 cut(s) 96, 345
BstDSI CCRYGG 1 cut(s) 143
BstKTI GATC 2 cut(s) 18, 150
BstMAI GTCTC 1 cut(s) 396
BstMBI GATC 2 cut(s) 15, 147
BstSFI CTRYAG 1 cut(s) 413
Bsu15I ATCGAT 1 cut(s) 14
BsuRI GGCC 1 cut(s) 37
BsuTUI ATCGAT 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 175
ClaI ATCGAT 1 cut(s) 14
CseI GACGC 1 cut(s) 38
Csp6I GTAC 1 cut(s) 253
CviAII CATG 1 cut(s) 144
CviJI RGCY 1 cut(s) 37
CviKI_1 RGCY 1 cut(s) 37
CviQI GTAC 1 cut(s) 253
DpnI GATC 2 cut(s) 17, 149
DpnII GATC 2 cut(s) 15, 147
DraI TTTAAA 1 cut(s) 310
EaeI YGGCCR 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 143
Eco47I GGWCC 1 cut(s) 175
EcoO109I RGGNCCY 1 cut(s) 175
EcoT14I CCWWGG 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 143
FaeI CATG 1 cut(s) 147
FaiI YATR 6 cut(s) 145, 212, 247, 270, 302, 415
FaqI GGGAC 1 cut(s) 180
FatI CATG 1 cut(s) 143
Fnu4HI GCNGC 1 cut(s) 362
Fsp4HI GCNGC 1 cut(s) 362
FspBI CTAG 1 cut(s) 197
GluI GCNGC 1 cut(s) 362
HaeIII GGCC 1 cut(s) 37
HapII CCGG 1 cut(s) 34
HgaI GACGC 1 cut(s) 38
Hin1II CATG 1 cut(s) 147
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 1 cut(s) 98
HpaII CCGG 1 cut(s) 34
Hpy166II GTNNAC 3 cut(s) 123, 184, 202
Hpy188I TCNGA 3 cut(s) 110, 243, 330
Hpy188III TCNNGA 2 cut(s) 58, 353
Hpy8I GTNNAC 3 cut(s) 123, 184, 202
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 79
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 1 cut(s) 147
Kzo9I GATC 2 cut(s) 15, 147
LpnPI CCDG 6 cut(s) 47, 190, 244, 362, 379, 384
LweI GCATC 1 cut(s) 20
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 160
MalI GATC 2 cut(s) 17, 149
MboI GATC 2 cut(s) 15, 147
MluCI AATT 2 cut(s) 112, 305
MmeI TCCRAC 4 cut(s) 163, 258, 276, 397
MnlI CCTC 4 cut(s) 16, 144, 166, 188
MseI TTAA 1 cut(s) 309
MspI CCGG 1 cut(s) 34
NcoI CCATGG 1 cut(s) 143
NdeII GATC 2 cut(s) 15, 147
NlaIII CATG 1 cut(s) 147
NspV TTCGAA 2 cut(s) 96, 345
PfeI GAWTC 1 cut(s) 98
PkrI GCNGC 1 cut(s) 363
PpuMI RGGWCCY 1 cut(s) 175
Psp5II RGGWCCY 1 cut(s) 175
PspPI GGNCC 1 cut(s) 175
PspPPI RGGWCCY 1 cut(s) 175
RsaI GTAC 1 cut(s) 254
RsaNI GTAC 1 cut(s) 253
SaqAI TTAA 1 cut(s) 309
SatI GCNGC 1 cut(s) 362
Sau3AI GATC 2 cut(s) 15, 147
Sau96I GGNCC 1 cut(s) 175
ScaI AGTACT 1 cut(s) 254
SetI ASST 4 cut(s) 27, 163, 180, 219
SfaNI GCATC 1 cut(s) 20
SfcI CTRYAG 1 cut(s) 413
SfuI TTCGAA 2 cut(s) 96, 345
SinI GGWCC 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 170
SmoI CTYRAG 1 cut(s) 170
Sse9I AATT 2 cut(s) 112, 305
SsiI CCGC 2 cut(s) 5, 361
SspMI CTAG 1 cut(s) 197
StyI CCWWGG 1 cut(s) 143
TaiI ACGT 1 cut(s) 163
TaqI TCGA 3 cut(s) 14, 96, 345
TasI AATT 2 cut(s) 112, 305
TatI WGTACW 1 cut(s) 252
TauI GCSGC 1 cut(s) 364
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 309
Tru9I TTAA 1 cut(s) 309
TspDTI ATGAA 1 cut(s) 399
TspGWI ACGGA 1 cut(s) 91
VpaK11BI GGWCC 1 cut(s) 175
XapI RAATTY 1 cut(s) 112
XspI CTAG 1 cut(s) 197
ZrmI AGTACT 1 cut(s) 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.