Rh6DG371200

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
56682663 .. 56682935
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG371200.1

Sequence Viewer

Length: 273 bp
ATGGCGGTGGCTTCGATCAAAGAGGCTGAAATCCGGCCATTGTTTGAGCGTCTGTTCAAGAGAGTTGAGGAAGCAATGCAGAGTTGTACCGAGTTTGAATCCCTCATCGGAAATTTCAAGTCCACGCTTGACCCTCTCCAACCATGGATCAAAGGAGAACGCAAGGGACTTGAGGACCTTGTGGACAAAGAATGTCTGGTTGACAGGGGCATAAAGGTAGTAGGCAAGTTCTCCAACGTTCAGATATCAGATATGGAAGTACTACTGGCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.21

Weight (kDa)

4.99

Isoelectric Point (pI)

31.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AclI AACGTT 1 cut(s) 237
AclWI GGATC 1 cut(s) 155
AcoI YGGCCR 1 cut(s) 35
AcsI RAATTY 1 cut(s) 112
AfaI GTAC 2 cut(s) 88, 261
AgsI TTSAA 3 cut(s) 58, 98, 118
AlwI GGATC 1 cut(s) 155
AoxI GGCC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 175
AvaII GGWCC 1 cut(s) 175
BmcAI AGTACT 1 cut(s) 261
Bme18I GGWCC 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 175
BpuEI CTTGAG 1 cut(s) 191
BsaJI CCNNGG 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 270
Bse3DI GCAATG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 143
BseMI GCAATG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 270
BshFI GGCC 1 cut(s) 37
BsiSI CCGG 1 cut(s) 34
BslFI GGGAC 1 cut(s) 180
BsmFI GGGAC 1 cut(s) 180
BsnI GGCC 1 cut(s) 37
Bsp143I GATC 2 cut(s) 15, 147
Bsp19I CCATGG 1 cut(s) 143
BspACI CCGC 1 cut(s) 5
BspANI GGCC 1 cut(s) 37
BspPI GGATC 1 cut(s) 155
BsrDI GCAATG 1 cut(s) 81
BsrI ACTGG 1 cut(s) 270
BssECI CCNNGG 1 cut(s) 143
BssMI GATC 2 cut(s) 15, 147
BssT1I CCWWGG 1 cut(s) 143
BstDSI CCRYGG 1 cut(s) 143
BstKTI GATC 2 cut(s) 18, 150
BstMBI GATC 2 cut(s) 15, 147
BsuRI GGCC 1 cut(s) 37
BtgI CCRYGG 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 175
CseI GACGC 1 cut(s) 38
Csp6I GTAC 2 cut(s) 87, 260
CviAII CATG 1 cut(s) 144
CviJI RGCY 3 cut(s) 11, 26, 37
CviKI_1 RGCY 3 cut(s) 11, 26, 37
CviQI GTAC 2 cut(s) 87, 260
DpnI GATC 2 cut(s) 17, 149
DpnII GATC 2 cut(s) 15, 147
EaeI YGGCCR 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 143
Eco32I GATATC 1 cut(s) 246
Eco47I GGWCC 1 cut(s) 175
EcoO109I RGGNCCY 1 cut(s) 175
EcoRV GATATC 1 cut(s) 246
EcoT14I CCWWGG 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 143
FaeI CATG 1 cut(s) 147
FaiI YATR 3 cut(s) 145, 212, 254
FaqI GGGAC 1 cut(s) 180
FatI CATG 1 cut(s) 143
HaeIII GGCC 1 cut(s) 37
HapII CCGG 1 cut(s) 34
HgaI GACGC 1 cut(s) 38
Hin1II CATG 1 cut(s) 147
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 1 cut(s) 98
HpaII CCGG 1 cut(s) 34
Hpy166II GTNNAC 3 cut(s) 123, 184, 202
Hpy188I TCNGA 3 cut(s) 110, 243, 250
Hpy188III TCNNGA 1 cut(s) 58
Hpy8I GTNNAC 3 cut(s) 123, 184, 202
HpyCH4IV ACGT 1 cut(s) 237
HpyCH4V TGCA 1 cut(s) 79
HpySE526I ACGT 1 cut(s) 237
Hsp92II CATG 1 cut(s) 147
Kzo9I GATC 2 cut(s) 15, 147
LpnPI CCDG 4 cut(s) 47, 182, 190, 251
MaeII ACGT 1 cut(s) 237
MalI GATC 2 cut(s) 17, 149
MboI GATC 2 cut(s) 15, 147
MluCI AATT 1 cut(s) 112
MmeI TCCRAC 2 cut(s) 163, 258
MnlI CCTC 5 cut(s) 16, 61, 113, 144, 166
MspI CCGG 1 cut(s) 34
NcoI CCATGG 1 cut(s) 143
NdeII GATC 2 cut(s) 15, 147
NlaIII CATG 1 cut(s) 147
PfeI GAWTC 1 cut(s) 98
PpuMI RGGWCCY 1 cut(s) 175
Psp1406I AACGTT 1 cut(s) 237
Psp5II RGGWCCY 1 cut(s) 175
PspPI GGNCC 1 cut(s) 175
PspPPI RGGWCCY 1 cut(s) 175
RsaI GTAC 2 cut(s) 88, 261
RsaNI GTAC 2 cut(s) 87, 260
Sau3AI GATC 2 cut(s) 15, 147
Sau96I GGNCC 1 cut(s) 175
ScaI AGTACT 1 cut(s) 261
SetI ASST 3 cut(s) 180, 219, 240
SinI GGWCC 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 170
SmoI CTYRAG 1 cut(s) 170
Sse9I AATT 1 cut(s) 112
SsiI CCGC 1 cut(s) 5
StyI CCWWGG 1 cut(s) 143
TaiI ACGT 1 cut(s) 240
TaqI TCGA 1 cut(s) 14
TasI AATT 1 cut(s) 112
TatI WGTACW 1 cut(s) 259
TfiI GAWTC 1 cut(s) 98
VpaK11BI GGWCC 1 cut(s) 175
XapI RAATTY 1 cut(s) 112
ZrmI AGTACT 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.