Rh7BG404400

UPF0369 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0005760
Physical Location & Seq
Reverse (-)
45197083 .. 45197406
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG404400.1

Sequence Viewer

Length: 324 bp
ATGGCGACGAATCTGAGCCGTCTGTTCTCATCAACAACGATGACGAAAGCCGAGCCTCTGACTCGCTCAGCTATCAACTCAGTGAGTCGGCTCTTGTCCTCCTCGACCCGGCAGTCTCAACCGGAGTGCGAAAACGCCGAGGTAAAATACGCCGGAAGCGCCGAACCTGACGACGAAAAGAGTGAAAAGCGAGATGAGGATGGTGAAGATGACAGAAAAAAGTTGGATTTGAATAAAGAGACGGGTGAGATCGGCGGGCCGAAAGGGCCTGAGCCGACCCGGTTCGGAGATTGGGAAAAAAACGGTCGGTGCTCTGATTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1674

Protein Analysis

107

Amino Acids

11.84

Weight (kDa)

4.85

Isoelectric Point (pI)

53.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1674 PF07896 61 - 107 3e-18 Protein of unknown function (DUF1674)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 112
AciI CCGC 1 cut(s) 255
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 1 cut(s) 232
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw21I GWGCWC 1 cut(s) 314
Alw26I GTCTC 2 cut(s) 120, 233
AoxI GGCC 2 cut(s) 257, 266
AspLEI GCGC 1 cut(s) 161
AspS9I GGNCC 2 cut(s) 257, 266
AsuC2I CCSGG 2 cut(s) 109, 280
AsuHPI GGTGA 2 cut(s) 215, 257
Bbv12I GWGCWC 1 cut(s) 314
BccI CCATC 1 cut(s) 194
BceAI ACGGC 1 cut(s) 3
BcnI CCSGG 2 cut(s) 109, 280
BcoDI GTCTC 2 cut(s) 120, 233
BfoI RGCGCY 1 cut(s) 162
BglI GCCNNNNNGGC 1 cut(s) 265
BlpI GCTNAGC 1 cut(s) 67
Bme1390I CCNGG 2 cut(s) 109, 280
BmgT120I GGNCC 2 cut(s) 257, 266
BmrFI CCNGG 2 cut(s) 109, 280
Bpu10I CCTNAGC 1 cut(s) 270
Bpu1102I GCTNAGC 1 cut(s) 67
BpuMI CCSGG 2 cut(s) 109, 280
BsaJI CCNNGG 1 cut(s) 138
BsaWI WCCGGW 1 cut(s) 121
Bsc4I CCNNNNNNNGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 1 cut(s) 205
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMII CTCAG 4 cut(s) 5, 81, 93, 261
BseRI GAGGAG 1 cut(s) 91
Bsh1285I CGRYCG 1 cut(s) 307
BshFI GGCC 2 cut(s) 259, 268
BsiEI CGRYCG 1 cut(s) 307
BsiHKAI GWGCWC 1 cut(s) 314
BsiSI CCGG 4 cut(s) 109, 122, 153, 280
BslI CCNNNNNNNGG 1 cut(s) 108
BsmAI GTCTC 2 cut(s) 120, 233
BsmBI CGTCTC 1 cut(s) 233
BsnI GGCC 2 cut(s) 259, 268
Bsp1286I GDGCHC 1 cut(s) 314
Bsp143I GATC 1 cut(s) 249
Bsp1720I GCTNAGC 1 cut(s) 67
BspACI CCGC 1 cut(s) 255
BspANI GGCC 2 cut(s) 259, 268
BspCNI CTCAG 4 cut(s) 6, 80, 92, 262
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 249
Bst4CI ACNGT 1 cut(s) 305
BstC8I GCNNGC 1 cut(s) 257
BstDEI CTNAG 4 cut(s) 14, 67, 79, 270
BstF5I GGATG 1 cut(s) 205
BstH2I RGCGCY 1 cut(s) 162
BstHHI GCGC 1 cut(s) 161
BstKTI GATC 1 cut(s) 252
BstMAI GTCTC 2 cut(s) 120, 233
BstMBI GATC 1 cut(s) 249
BstMCI CGRYCG 1 cut(s) 307
BstMWI GCNNNNNNNGC 2 cut(s) 158, 265
BstSCI CCNGG 2 cut(s) 107, 278
BsuRI GGCC 2 cut(s) 259, 268
BtsCI GGATG 1 cut(s) 205
BtsIMutI CAGTG 1 cut(s) 87
Cac8I GCNNGC 1 cut(s) 257
CfoI GCGC 1 cut(s) 161
Cfr13I GGNCC 2 cut(s) 257, 266
CviJI RGCY 8 cut(s) 18, 50, 55, 71, 91, 259, 268, 274
CviKI_1 RGCY 8 cut(s) 18, 50, 55, 71, 91, 259, 268, 274
DdeI CTNAG 4 cut(s) 14, 67, 79, 270
DpnI GATC 1 cut(s) 251
DpnII GATC 1 cut(s) 249
DrdI GACNNNNNNGTC 1 cut(s) 112
DseDI GACNNNNNNGTC 1 cut(s) 112
EcoO109I RGGNCCY 1 cut(s) 266
Esp3I CGTCTC 1 cut(s) 233
FauI CCCGC 1 cut(s) 248
FokI GGATG 1 cut(s) 212
GlaI GCGC 1 cut(s) 160
HaeII RGCGCY 1 cut(s) 162
HaeIII GGCC 2 cut(s) 259, 268
HapII CCGG 4 cut(s) 109, 122, 153, 280
HhaI GCGC 1 cut(s) 161
Hin6I GCGC 1 cut(s) 159
HinP1I GCGC 1 cut(s) 159
HinfI GANTC 3 cut(s) 10, 61, 85
HpaII CCGG 4 cut(s) 109, 122, 153, 280
HphI GGTGA 2 cut(s) 215, 257
Hpy188I TCNGA 4 cut(s) 15, 60, 287, 316
Hpy99I CGWCG 2 cut(s) 10, 176
HpyCH4III ACNGT 1 cut(s) 305
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 265
HpyF3I CTNAG 4 cut(s) 14, 67, 79, 270
HspAI GCGC 1 cut(s) 159
Kzo9I GATC 1 cut(s) 249
LpnPI CCDG 6 cut(s) 122, 135, 166, 180, 282, 293
MalI GATC 1 cut(s) 251
MboI GATC 1 cut(s) 249
MboII GAAGA 1 cut(s) 218
MhlI GDGCHC 1 cut(s) 314
MlyI GAGTC 2 cut(s) 55, 94
MmeI TCCRAC 1 cut(s) 204
MnlI CCTC 5 cut(s) 66, 109, 112, 133, 190
MspI CCGG 4 cut(s) 109, 122, 153, 280
MspR9I CCNGG 2 cut(s) 109, 280
MwoI GCNNNNNNNGC 2 cut(s) 158, 265
NciI CCSGG 2 cut(s) 109, 280
NdeII GATC 1 cut(s) 249
NmeAIII GCCGAG 2 cut(s) 76, 163
PfeI GAWTC 1 cut(s) 10
PleI GAGTC 2 cut(s) 55, 93
PpsI GAGTC 2 cut(s) 55, 93
PspPI GGNCC 2 cut(s) 257, 266
Sau3AI GATC 1 cut(s) 249
Sau96I GGNCC 2 cut(s) 257, 266
SchI GAGTC 2 cut(s) 55, 94
ScrFI CCNGG 2 cut(s) 109, 280
SduI GDGCHC 1 cut(s) 314
SetI ASST 3 cut(s) 73, 144, 169
SfiI GGCCNNNNNGGCC 1 cut(s) 265
SsiI CCGC 1 cut(s) 255
StyD4I CCNGG 2 cut(s) 107, 278
TaaI ACNGT 1 cut(s) 305
TaqI TCGA 1 cut(s) 104
TfiI GAWTC 1 cut(s) 10
TscAI CASTG 1 cut(s) 87
TspRI CASTG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.