Rh7CG274500

RNA polymerase II C-terminal domain phosphatase-like 4

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
27504387 .. 27506204
1818 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG274500.1

Sequence Viewer

Length: 264 bp
ATGACAACTCTATCTCAACCAATGTTGTTTCAGGAGAAGGAAAATTTTGATCTTAATGGTAATCTTTCATTTCCTTCTTCTTTTCATGTTTCAAATTGTTCTTCTAACCCTAATTTTGCCAGAGCACTGAGTTTGAATTCCAACTCCAGAAAGCTCCACTTGGTTCTTGATCTGGATCACACACTCCTCCACACCACTCAACTCTGTAATCTGACACCTGAAGAAGACTATCTCAAGATCGGAACCCATCCTCATCGATTTTAA

Protein Analysis

87

Amino Acids

9.93

Weight (kDa)

6.26

Isoelectric Point (pI)

22.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 183
AcsI RAATTY 2 cut(s) 43, 136
AcuI CTGAAG 1 cut(s) 240
AgsI TTSAA 2 cut(s) 93, 136
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
Alw21I GWGCWC 1 cut(s) 127
AlwI GGATC 1 cut(s) 183
ApoI RAATTY 2 cut(s) 43, 136
BbsI GAAGAC 1 cut(s) 231
Bbv12I GWGCWC 1 cut(s) 127
BccI CCATC 1 cut(s) 255
BmiI GGNNCC 1 cut(s) 244
BpiI GAAGAC 1 cut(s) 231
BpmI CTGGAG 1 cut(s) 130
BpuEI CTTGAG 1 cut(s) 218
Bsa29I ATCGAT 1 cut(s) 256
BsaBI GATNNNNATC 1 cut(s) 174
Bse8I GATNNNNATC 1 cut(s) 174
BseCI ATCGAT 1 cut(s) 256
BseGI GGATG 1 cut(s) 247
BseJI GATNNNNATC 1 cut(s) 174
BseMII CTCAG 1 cut(s) 119
BseRI GAGGAG 1 cut(s) 176
BshVI ATCGAT 1 cut(s) 256
BsiHKAI GWGCWC 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 127
Bsp143I GATC 4 cut(s) 49, 169, 175, 237
BspCNI CTCAG 1 cut(s) 120
BspDI ATCGAT 1 cut(s) 256
BspLI GGNNCC 1 cut(s) 244
BspPI GGATC 1 cut(s) 183
BssMI GATC 4 cut(s) 49, 169, 175, 237
BstDEI CTNAG 1 cut(s) 128
BstF5I GGATG 1 cut(s) 247
BstKTI GATC 4 cut(s) 52, 172, 178, 240
BstMBI GATC 4 cut(s) 49, 169, 175, 237
BstV2I GAAGAC 1 cut(s) 231
Bsu15I ATCGAT 1 cut(s) 256
BsuTUI ATCGAT 1 cut(s) 256
BtsCI GGATG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 125
ClaI ATCGAT 1 cut(s) 256
CviAII CATG 1 cut(s) 86
CviJI RGCY 1 cut(s) 154
CviKI_1 RGCY 1 cut(s) 154
DdeI CTNAG 1 cut(s) 128
DpnI GATC 4 cut(s) 51, 171, 177, 239
DpnII GATC 4 cut(s) 49, 169, 175, 237
Eco57I CTGAAG 1 cut(s) 240
EcoRI GAATTC 1 cut(s) 136
FaeI CATG 1 cut(s) 89
FaiI YATR 1 cut(s) 87
FalI AAGNNNNNCTT 2 cut(s) 143, 175
FatI CATG 1 cut(s) 85
FokI GGATG 1 cut(s) 234
GsuI CTGGAG 1 cut(s) 130
Hin1II CATG 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 213, 242
Hpy188III TCNNGA 5 cut(s) 32, 147, 167, 173, 235
HpyAV CCTTC 2 cut(s) 31, 84
HpyF3I CTNAG 1 cut(s) 128
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 4 cut(s) 49, 169, 175, 237
LmnI GCTCC 1 cut(s) 159
LpnPI CCDG 5 cut(s) 17, 133, 158, 160, 231
MalI GATC 4 cut(s) 51, 171, 177, 239
MboI GATC 4 cut(s) 49, 169, 175, 237
MboII GAAGA 4 cut(s) 69, 93, 233, 236
MhlI GDGCHC 1 cut(s) 127
MluCI AATT 4 cut(s) 43, 94, 112, 136
MmeI TCCRAC 1 cut(s) 165
MnlI CCTC 2 cut(s) 197, 261
MseI TTAA 2 cut(s) 54, 262
NdeII GATC 4 cut(s) 49, 169, 175, 237
NlaIII CATG 1 cut(s) 89
NlaIV GGNNCC 1 cut(s) 244
PspN4I GGNNCC 1 cut(s) 244
SaqAI TTAA 2 cut(s) 54, 262
Sau3AI GATC 4 cut(s) 49, 169, 175, 237
SduI GDGCHC 1 cut(s) 127
SetI ASST 2 cut(s) 156, 220
SgeI CNNG 9 cut(s) 44, 98, 132, 159, 172, 179, 185, 230, 247
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
Sse9I AATT 4 cut(s) 43, 94, 112, 136
TaqI TCGA 1 cut(s) 256
TasI AATT 4 cut(s) 43, 94, 112, 136
Tru1I TTAA 2 cut(s) 54, 262
Tru9I TTAA 2 cut(s) 54, 262
TscAI CASTG 1 cut(s) 132
TspDTI ATGAA 2 cut(s) 57, 74
TspRI CASTG 1 cut(s) 132
XapI RAATTY 2 cut(s) 43, 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.