Rh7CG430100

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
56326865 .. 56342593
15729 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG430100.1

Sequence Viewer

Length: 231 bp
ATGGGGTTTGATAGAAGCAGAATTGTTGGGGAAGGAGCAACAGCTAAGGTTTACAGAGGGTCTCTGTTATCTGGTGGAGAAGTGGCAGTCAAAAGGTTCGGAAGGGCTAATGGGATTGATCGTTTGGGTAGTCCTTTTACTACTGAGTTTGCAACAATGGCAGGGAGGAATAAAGATGGCAGAACTCCCATAGATCGGCTTTACAGTATCACAAAACATGTATGCCGCTAG

Protein Analysis

76

Amino Acids

8.28

Weight (kDa)

10.55

Isoelectric Point (pI)

25.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 226
AfiI CCNNNNNNNGG 1 cut(s) 195
AflIII ACRYGT 1 cut(s) 217
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 66
BccI CCATC 1 cut(s) 170
BcoDI GTCTC 1 cut(s) 66
BfaI CTAG 1 cut(s) 229
BisI GCNGC 1 cut(s) 226
BlsI GCNGC 1 cut(s) 227
Bpu10I CCTNAGC 1 cut(s) 45
BsaI GGTCTC 1 cut(s) 66
Bsc4I CCNNNNNNNGG 1 cut(s) 195
BseLI CCNNNNNNNGG 1 cut(s) 195
BseMII CTCAG 1 cut(s) 135
BslI CCNNNNNNNGG 1 cut(s) 195
BsmAI GTCTC 1 cut(s) 66
Bso31I GGTCTC 1 cut(s) 66
Bsp143I GATC 2 cut(s) 118, 193
BspACI CCGC 1 cut(s) 226
BspCNI CTCAG 1 cut(s) 136
BspTNI GGTCTC 1 cut(s) 66
BssMI GATC 2 cut(s) 118, 193
Bst4CI ACNGT 1 cut(s) 206
BstDEI CTNAG 2 cut(s) 45, 144
BstKTI GATC 2 cut(s) 121, 196
BstMAI GTCTC 1 cut(s) 66
BstMBI GATC 2 cut(s) 118, 193
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstNSI RCATGY 1 cut(s) 221
CviAII CATG 1 cut(s) 218
CviJI RGCY 3 cut(s) 44, 107, 199
CviKI_1 RGCY 3 cut(s) 44, 107, 199
DdeI CTNAG 2 cut(s) 45, 144
DpnI GATC 2 cut(s) 120, 195
DpnII GATC 2 cut(s) 118, 193
Eco31I GGTCTC 1 cut(s) 66
FaeI CATG 1 cut(s) 221
FaiI YATR 3 cut(s) 191, 219, 223
FatI CATG 1 cut(s) 217
Fnu4HI GCNGC 1 cut(s) 226
Fsp4HI GCNGC 1 cut(s) 226
FspBI CTAG 1 cut(s) 229
GluI GCNGC 1 cut(s) 226
Hin1II CATG 1 cut(s) 221
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 101
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 2 cut(s) 26, 96
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 2 cut(s) 45, 144
Hsp92II CATG 1 cut(s) 221
Kzo9I GATC 2 cut(s) 118, 193
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 2 cut(s) 57, 147
MaeI CTAG 1 cut(s) 229
MalI GATC 2 cut(s) 120, 195
MboI GATC 2 cut(s) 118, 193
MluCI AATT 1 cut(s) 21
MnlI CCTC 2 cut(s) 50, 159
MwoI GCNNNNNNNGC 1 cut(s) 158
NdeII GATC 2 cut(s) 118, 193
NlaIII CATG 1 cut(s) 221
NspI RCATGY 1 cut(s) 221
PciI ACATGT 1 cut(s) 217
PkrI GCNGC 1 cut(s) 227
PscI ACATGT 1 cut(s) 217
SatI GCNGC 1 cut(s) 226
Sau3AI GATC 2 cut(s) 118, 193
SetI ASST 3 cut(s) 46, 51, 98
SgeI CNNG 2 cut(s) 84, 174
Sse9I AATT 1 cut(s) 21
SsiI CCGC 1 cut(s) 226
SspMI CTAG 1 cut(s) 229
TaaI ACNGT 1 cut(s) 206
TasI AATT 1 cut(s) 21
TauI GCSGC 1 cut(s) 228
XceI RCATGY 1 cut(s) 221
XspI CTAG 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.