AT1G60625

Rapid ALkalinization Factor (RALF)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0006496
Physical Location & Seq
Forward (+)
22333916 .. 22334161
246 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G60625.1

Sequence Viewer

Length: 246 bp
ATGGCTGCACACAAAAAGAGTCATATCCGCATTTTCTTTGTTTCAGTAATGATTATATTATCATTGTTCAGCGGATTTGGAGAAGGACAAACATATATAAACTATAATGGTATGAAAGGAGACATAATTCCAGGTTGCAGCAGTAAGAATCCCAAAGAATGTGTCAAAATTCCAGCATACTCTTACAATCGTGGTTGTGAAATCTCTACACGTTGTCAACGTCAACAGCATTCGAGTTCGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RALF

Protein Analysis

81

Amino Acids

9.04

Weight (kDa)

9.42

Isoelectric Point (pI)

36.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RALF PF05498 28 - 74 1.9e-07 Rapid ALkalinization Factor (RALF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 28, 72
AcsI RAATTY 1 cut(s) 168
AflIII ACRYGT 1 cut(s) 209
AjnI CCWGG 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 114
ApeKI GCWGC 2 cut(s) 5, 138
ApoI RAATTY 1 cut(s) 168
ArsI GACNNNNNNTTYG 2 cut(s) 147, 179
BbvI GCAGC 1 cut(s) 150
BciT130I CCWGG 1 cut(s) 132
BcoDI GTCTC 1 cut(s) 114
BisI GCNGC 2 cut(s) 6, 139
BlsI GCNGC 2 cut(s) 7, 140
Bme1390I CCNGG 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 132
BseXI GCAGC 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 114
BsmI GAATGC 1 cut(s) 229
BspACI CCGC 2 cut(s) 28, 72
Bst2UI CCWGG 1 cut(s) 132
BstMAI GTCTC 1 cut(s) 114
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BstV1I GCAGC 1 cut(s) 150
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 130
FaiI YATR 9 cut(s) 24, 56, 94, 96, 98, 105, 113, 125, 178
Fnu4HI GCNGC 2 cut(s) 6, 139
Fsp4HI GCNGC 2 cut(s) 6, 139
GluI GCNGC 2 cut(s) 6, 139
HincII GTYRAC 2 cut(s) 218, 224
HindII GTYRAC 2 cut(s) 218, 224
HinfI GANTC 2 cut(s) 19, 148
Hpy166II GTNNAC 2 cut(s) 218, 224
Hpy8I GTNNAC 2 cut(s) 218, 224
HpyAV CCTTC 1 cut(s) 77
HpyCH4IV ACGT 2 cut(s) 211, 220
HpyCH4V TGCA 2 cut(s) 8, 138
HpySE526I ACGT 2 cut(s) 211, 220
LpnPI CCDG 3 cut(s) 117, 144, 186
Lsp1109I GCAGC 1 cut(s) 150
MaeII ACGT 2 cut(s) 211, 220
MluCI AATT 2 cut(s) 126, 168
MlyI GAGTC 1 cut(s) 28
MseI TTAA 1 cut(s) 244
MspA1I CMGCKG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 132
Mva1269I GAATGC 1 cut(s) 229
MvaI CCWGG 1 cut(s) 132
PcsI WCGNNNNNNNCGW 1 cut(s) 217
PctI GAATGC 1 cut(s) 229
PfeI GAWTC 1 cut(s) 148
PkrI GCNGC 2 cut(s) 7, 140
PleI GAGTC 1 cut(s) 27
PpsI GAGTC 1 cut(s) 27
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
SaqAI TTAA 1 cut(s) 244
SatI GCNGC 2 cut(s) 6, 139
SchI GAGTC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 132
SetI ASST 3 cut(s) 136, 214, 223
SgeI CNNG 5 cut(s) 143, 144, 185, 203, 222
Sse9I AATT 2 cut(s) 126, 168
SsiI CCGC 2 cut(s) 28, 72
StyD4I CCNGG 1 cut(s) 130
TaiI ACGT 2 cut(s) 214, 223
TaqI TCGA 2 cut(s) 233, 239
TasI AATT 2 cut(s) 126, 168
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 1 cut(s) 244
Tru9I TTAA 1 cut(s) 244
TseI GCWGC 2 cut(s) 5, 138
TspDTI ATGAA 1 cut(s) 128
XapI RAATTY 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.