AT1G60815

Rapid ALkalinization Factor (RALF)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0006496
Physical Location & Seq
Forward (+)
22392729 .. 22392974
246 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G60815.1

Sequence Viewer

Length: 246 bp
ATGTCTGCACGCAAAAAGAATCGTATCCATGTTTTCTTTGTTTCAATAATGATTATAATATCATTGGTCAGCGGATTTGGAGAAGGAATAAAACAGATAAACTATAAAGATTTGATAAAAGACACAATTCCAGGTTGCACTAGTAAGAACCCTAAAGAATGCGTCAAAGTTCCAGCCAACACTTACCATCGTGGTTGTGAAATTTCTACACGTTGTCATCGTGAACAGCATTCGAGTTCGGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RALF

Protein Analysis

81

Amino Acids

9.09

Weight (kDa)

9.59

Isoelectric Point (pI)

37.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RALF PF05498 31 - 74 2.3e-07 Rapid ALkalinization Factor (RALF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 56
AciI CCGC 1 cut(s) 72
AcsI RAATTY 1 cut(s) 201
AflIII ACRYGT 1 cut(s) 209
AgsI TTSAA 1 cut(s) 45
AhlI ACTAGT 1 cut(s) 140
AjnI CCWGG 1 cut(s) 130
ApoI RAATTY 1 cut(s) 201
BccI CCATC 1 cut(s) 195
BciT130I CCWGG 1 cut(s) 132
BciVI GTATCC 1 cut(s) 35
BcuI ACTAGT 1 cut(s) 140
BfaI CTAG 1 cut(s) 141
BfuI GTATCC 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 132
BsmI GAATGC 2 cut(s) 164, 229
BspACI CCGC 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 10
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BsuI GTATCC 1 cut(s) 35
Cac8I GCNNGC 1 cut(s) 10
CseI GACGC 1 cut(s) 151
CviAII CATG 1 cut(s) 29
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
EcoRII CCWGG 1 cut(s) 130
FaeI CATG 1 cut(s) 32
FaiI YATR 3 cut(s) 30, 56, 105
FatI CATG 1 cut(s) 28
FspBI CTAG 1 cut(s) 141
HgaI GACGC 1 cut(s) 151
Hin1II CATG 1 cut(s) 32
HinfI GANTC 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 224
Hpy188III TCNNGA 1 cut(s) 221
Hpy8I GTNNAC 1 cut(s) 224
HpyAV CCTTC 1 cut(s) 77
HpyCH4IV ACGT 1 cut(s) 211
HpyCH4V TGCA 2 cut(s) 8, 138
HpySE526I ACGT 1 cut(s) 211
Hsp92II CATG 1 cut(s) 32
LpnPI CCDG 3 cut(s) 117, 144, 186
MaeI CTAG 1 cut(s) 141
MaeII ACGT 1 cut(s) 211
MluCI AATT 2 cut(s) 126, 201
MseI TTAA 1 cut(s) 244
MspA1I CMGCKG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 132
Mva1269I GAATGC 2 cut(s) 164, 229
MvaI CCWGG 1 cut(s) 132
NlaIII CATG 1 cut(s) 32
PcsI WCGNNNNNNNCGW 1 cut(s) 217
PctI GAATGC 2 cut(s) 164, 229
PfeI GAWTC 1 cut(s) 19
PsiI TTATAA 1 cut(s) 56
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
SaqAI TTAA 1 cut(s) 244
ScrFI CCNGG 1 cut(s) 132
SetI ASST 2 cut(s) 136, 214
SgeI CNNG 9 cut(s) 21, 41, 143, 144, 153, 185, 203, 222, 233
SpeI ACTAGT 1 cut(s) 140
Sse9I AATT 2 cut(s) 126, 201
SsiI CCGC 1 cut(s) 72
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 130
TaiI ACGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 233
TasI AATT 2 cut(s) 126, 201
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 1 cut(s) 244
Tru9I TTAA 1 cut(s) 244
XapI RAATTY 1 cut(s) 201
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.