AT4G11510

Cell signaling peptide that may regulate plant stress, growth, and development. Mediates a rapid alkalinization of extracellular space by mediating a transient increase in the cytoplasmic Ca(2 ) concentration leading to a calcium-dependent signaling events through a cell surface receptor and a concomitant activation of some intracellular mitogen-activated protein kinases (By similarity)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0006496
Physical Location & Seq
Reverse (-)
6983911 .. 6984369
459 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G11510.1

Sequence Viewer

Length: 258 bp
ATGAGCATTTTGAAAGAAACAAAAAGGTTTATGGTCGTGGCAATGTTCATAGCATGTGTGTTCATAAGCAACAACATGAACGTAGCAGTTGCAAATGAGATTGGCTATCCAGGAATGGGACGCGGCGATCGCCAACCAGGATGTGATCATGGCAACTGTCCACCCGATCAACCGGCGAATCCGTACCATCGAGGATGTGAAAAATCAAAGAGATGTCGTGGTCCAGATCCACCAGCTCTTCCTCGAAAGATGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RALF

Protein Analysis

85

Amino Acids

9.39

Weight (kDa)

9.19

Isoelectric Point (pI)

49.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RALF PF05498 45 - 74 4.9e-06 Rapid ALkalinization Factor (RALF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 123
AciI CCGC 1 cut(s) 123
AclWI GGATC 1 cut(s) 221
AfaI GTAC 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 1 cut(s) 13
AjnI CCWGG 2 cut(s) 109, 136
AluBI AGCT 1 cut(s) 236
AluI AGCT 1 cut(s) 236
AlwI GGATC 1 cut(s) 221
AsiSI GCGATCGC 1 cut(s) 130
AspS9I GGNCC 1 cut(s) 221
AvaII GGWCC 1 cut(s) 221
BccI CCATC 1 cut(s) 195
BciT130I CCWGG 2 cut(s) 111, 138
BclI TGATCA 1 cut(s) 145
BisI GCNGC 1 cut(s) 124
BlsI GCNGC 1 cut(s) 125
Bme1390I CCNGG 2 cut(s) 111, 138
Bme18I GGWCC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 221
BmrFI CCNGG 2 cut(s) 111, 138
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse118I RCCGGY 1 cut(s) 172
Bse3DI GCAATG 1 cut(s) 48
BseBI CCWGG 2 cut(s) 111, 138
BseGI GGATG 2 cut(s) 146, 200
BseLI CCNNNNNNNGG 1 cut(s) 116
BseMI GCAATG 1 cut(s) 48
Bsh1236I CGCG 1 cut(s) 123
Bsh1285I CGRYCG 1 cut(s) 130
BsiEI CGRYCG 1 cut(s) 130
BsiSI CCGG 1 cut(s) 173
BslFI GGGAC 1 cut(s) 132
BslI CCNNNNNNNGG 1 cut(s) 116
BsmFI GGGAC 1 cut(s) 132
Bsp143I GATC 4 cut(s) 127, 145, 166, 226
BspACI CCGC 1 cut(s) 123
BspFNI CGCG 1 cut(s) 123
BspPI GGATC 1 cut(s) 221
BspQI GCTCTTC 1 cut(s) 243
BsrDI GCAATG 1 cut(s) 48
BsrFI RCCGGY 1 cut(s) 172
BssAI RCCGGY 1 cut(s) 172
BssMI GATC 4 cut(s) 127, 145, 166, 226
Bst2UI CCWGG 2 cut(s) 111, 138
Bst4CI ACNGT 1 cut(s) 158
Bst6I CTCTTC 1 cut(s) 243
BstF5I GGATG 2 cut(s) 146, 200
BstFNI CGCG 1 cut(s) 123
BstKTI GATC 4 cut(s) 130, 148, 169, 229
BstMBI GATC 4 cut(s) 127, 145, 166, 226
BstMCI CGRYCG 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 129
BstNI CCWGG 2 cut(s) 111, 138
BstNSI RCATGY 1 cut(s) 57
BstSCI CCNGG 2 cut(s) 109, 136
BstUI CGCG 1 cut(s) 123
BstX2I RGATCY 1 cut(s) 226
BstYI RGATCY 1 cut(s) 226
BtsCI GGATG 2 cut(s) 146, 200
Cfr10I RCCGGY 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 221
CseI GACGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 184
CviAII CATG 3 cut(s) 54, 76, 149
CviJI RGCY 2 cut(s) 105, 236
CviKI_1 RGCY 2 cut(s) 105, 236
CviQI GTAC 1 cut(s) 184
DpnI GATC 4 cut(s) 129, 147, 168, 228
DpnII GATC 4 cut(s) 127, 145, 166, 226
Eam1104I CTCTTC 1 cut(s) 243
EarI CTCTTC 1 cut(s) 243
Eco47I GGWCC 1 cut(s) 221
EcoRII CCWGG 2 cut(s) 109, 136
FaeI CATG 3 cut(s) 57, 79, 152
FaiI YATR 7 cut(s) 32, 50, 55, 65, 77, 150, 256
FaqI GGGAC 1 cut(s) 132
FatI CATG 3 cut(s) 53, 75, 148
FbaI TGATCA 1 cut(s) 145
Fnu4HI GCNGC 1 cut(s) 124
FokI GGATG 2 cut(s) 153, 207
Fsp4HI GCNGC 1 cut(s) 124
GluI GCNGC 1 cut(s) 124
HapII CCGG 1 cut(s) 173
HgaI GACGC 1 cut(s) 129
Hin1II CATG 3 cut(s) 57, 79, 152
HinfI GANTC 1 cut(s) 178
HpaII CCGG 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 161
Hpy188III TCNNGA 1 cut(s) 224
Hpy8I GTNNAC 1 cut(s) 161
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 129
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 3 cut(s) 57, 79, 152
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 4 cut(s) 127, 145, 166, 226
LguI GCTCTTC 1 cut(s) 243
LpnPI CCDG 7 cut(s) 96, 123, 123, 150, 186, 237, 246
MaeII ACGT 1 cut(s) 81
MalI GATC 4 cut(s) 129, 147, 168, 228
MboI GATC 4 cut(s) 127, 145, 166, 226
MboII GAAGA 1 cut(s) 230
MflI RGATCY 1 cut(s) 226
MnlI CCTC 2 cut(s) 185, 252
MspI CCGG 1 cut(s) 173
MspR9I CCNGG 2 cut(s) 111, 138
MvaI CCWGG 2 cut(s) 111, 138
MvnI CGCG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 129
NdeII GATC 4 cut(s) 127, 145, 166, 226
NlaIII CATG 3 cut(s) 57, 79, 152
NspI RCATGY 1 cut(s) 57
PciSI GCTCTTC 1 cut(s) 243
PfeI GAWTC 1 cut(s) 178
PfoI TCCNGGA 1 cut(s) 109
PkrI GCNGC 1 cut(s) 125
Ple19I CGATCG 1 cut(s) 130
Psp6I CCWGG 2 cut(s) 109, 136
PspGI CCWGG 2 cut(s) 109, 136
PspPI GGNCC 1 cut(s) 221
PsuI RGATCY 1 cut(s) 226
PvuI CGATCG 1 cut(s) 130
RgaI GCGATCGC 1 cut(s) 130
RsaI GTAC 1 cut(s) 185
RsaNI GTAC 1 cut(s) 184
SapI GCTCTTC 1 cut(s) 243
SatI GCNGC 1 cut(s) 124
Sau3AI GATC 4 cut(s) 127, 145, 166, 226
Sau96I GGNCC 1 cut(s) 221
ScrFI CCNGG 2 cut(s) 111, 138
SetI ASST 3 cut(s) 29, 84, 238
SfaAI GCGATCGC 1 cut(s) 130
SgfI GCGATCGC 1 cut(s) 130
SinI GGWCC 1 cut(s) 221
SsiI CCGC 1 cut(s) 123
StyD4I CCNGG 2 cut(s) 109, 136
TaaI ACNGT 1 cut(s) 158
TaiI ACGT 1 cut(s) 84
TaqI TCGA 2 cut(s) 190, 244
TauI GCSGC 1 cut(s) 126
TfiI GAWTC 1 cut(s) 178
TspDTI ATGAA 3 cut(s) 37, 52, 92
TspGWI ACGGA 1 cut(s) 171
VpaK11BI GGWCC 1 cut(s) 221
XceI RCATGY 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.