Rroxscaffold_2G00092050

Rapid ALkalinization Factor (RALF)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0006496
Physical Location & Seq
Forward (+)
13615326 .. 13615595
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00092050.1

Sequence Viewer

Length: 270 bp
ATGGCATCAGTTGTGTTCAAGGCAATAAGTGTTTTGTGCCTAACTATGTTTGTATCAGTTTTGCTGATTGAAGAAGTAGATGGCAGTAAGTATATAGACTACGGAGCTATTAAAGGAGATGAAATTCCGGGATGCAGCGATAAGCATCCAGAAAATTGTTACCCAAAAAGGGCAAATCGATATCAAAGAGGTTGTAACCCGGAAACGCGATGCAGACAAGTCCATACCACAACAGCACCCAAAGGCGAAAGTGTAGGATCAACCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RALF

Protein Analysis

89

Amino Acids

9.8

Weight (kDa)

8.3

Isoelectric Point (pI)

23.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RALF PF05498 27 - 72 7.1e-11 Rapid ALkalinization Factor (RALF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 208
AclWI GGATC 1 cut(s) 265
AcsI RAATTY 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 169
AgsI TTSAA 2 cut(s) 19, 71
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AlwI GGATC 1 cut(s) 265
ApeKI GCWGC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 123
AsuC2I CCSGG 2 cut(s) 129, 200
BbvI GCAGC 1 cut(s) 147
BccI CCATC 1 cut(s) 74
BcnI CCSGG 2 cut(s) 129, 200
BisI GCNGC 1 cut(s) 136
BlsI GCNGC 1 cut(s) 137
Bme1390I CCNGG 2 cut(s) 129, 200
BmrFI CCNGG 2 cut(s) 129, 200
BmsI GCATC 4 cut(s) 14, 122, 154, 200
BpuMI CCSGG 2 cut(s) 129, 200
Bsa29I ATCGAT 1 cut(s) 178
BsaBI GATNNNNATC 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 169
Bse8I GATNNNNATC 1 cut(s) 144
BseCI ATCGAT 1 cut(s) 178
BseGI GGATG 2 cut(s) 137, 145
BseJI GATNNNNATC 1 cut(s) 144
BseLI CCNNNNNNNGG 1 cut(s) 169
BseXI GCAGC 1 cut(s) 147
Bsh1236I CGCG 1 cut(s) 208
BshVI ATCGAT 1 cut(s) 178
BsiSI CCGG 2 cut(s) 128, 200
BslI CCNNNNNNNGG 1 cut(s) 169
Bsp143I GATC 1 cut(s) 257
BspDI ATCGAT 1 cut(s) 178
BspFNI CGCG 1 cut(s) 208
BspPI GGATC 1 cut(s) 265
BssMI GATC 1 cut(s) 257
BstF5I GGATG 2 cut(s) 137, 145
BstFNI CGCG 1 cut(s) 208
BstKTI GATC 1 cut(s) 260
BstMBI GATC 1 cut(s) 257
BstSCI CCNGG 2 cut(s) 127, 198
BstUI CGCG 1 cut(s) 208
BstV1I GCAGC 1 cut(s) 147
Bsu15I ATCGAT 1 cut(s) 178
BsuTUI ATCGAT 1 cut(s) 178
BtgZI GCGATG 1 cut(s) 223
BtsCI GGATG 2 cut(s) 137, 145
ClaI ATCGAT 1 cut(s) 178
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DpnI GATC 1 cut(s) 259
DpnII GATC 1 cut(s) 257
Eco32I GATATC 1 cut(s) 182
EcoRV GATATC 1 cut(s) 182
FaiI YATR 4 cut(s) 47, 93, 95, 225
Fnu4HI GCNGC 1 cut(s) 136
FokI GGATG 2 cut(s) 132, 144
Fsp4HI GCNGC 1 cut(s) 136
GluI GCNGC 1 cut(s) 136
HapII CCGG 2 cut(s) 128, 200
HpaII CCGG 2 cut(s) 128, 200
Hpy188III TCNNGA 1 cut(s) 149
HpyCH4V TGCA 2 cut(s) 135, 213
Kzo9I GATC 1 cut(s) 257
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 3 cut(s) 141, 162, 213
Lsp1109I GCAGC 1 cut(s) 147
LweI GCATC 4 cut(s) 14, 122, 154, 200
MaeIII GTNAC 2 cut(s) 158, 194
MalI GATC 1 cut(s) 259
MboI GATC 1 cut(s) 257
MboII GAAGA 1 cut(s) 83
MluCI AATT 2 cut(s) 123, 154
MnlI CCTC 1 cut(s) 182
MseI TTAA 1 cut(s) 111
MspI CCGG 2 cut(s) 128, 200
MspR9I CCNGG 2 cut(s) 129, 200
MvnI CGCG 1 cut(s) 208
NciI CCSGG 2 cut(s) 129, 200
NdeII GATC 1 cut(s) 257
PfoI TCCNGGA 1 cut(s) 127
PkrI GCNGC 1 cut(s) 137
SaqAI TTAA 1 cut(s) 111
SatI GCNGC 1 cut(s) 136
Sau3AI GATC 1 cut(s) 257
ScrFI CCNGG 2 cut(s) 129, 200
SetI ASST 2 cut(s) 109, 193
SfaNI GCATC 4 cut(s) 14, 122, 154, 200
SgeI CNNG 8 cut(s) 31, 140, 141, 161, 211, 212, 219, 230
Sse9I AATT 2 cut(s) 123, 154
StyD4I CCNGG 2 cut(s) 127, 198
TaqI TCGA 1 cut(s) 178
TasI AATT 2 cut(s) 123, 154
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TseI GCWGC 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 135
TspGWI ACGGA 1 cut(s) 117
XapI RAATTY 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.