AT1G60913

Rapid ALkalinization Factor (RALF)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0006496
Physical Location & Seq
Reverse (-)
22428605 .. 22428914
310 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G60913.1

Sequence Viewer

Length: 240 bp
ATGGCTGCACACAAAATGAGTCTTACTAGTCTTTTCTTTGTGTCAATAGTGATTGTATTATCATTGTTCAGCGGATTCGGAGAAGGAAGATACATAAAATATAGAGCTATTGCAAAAGATAGAGTTCCAGACTGCACTCAAGATCCCAAAAATTGTGTCAGAGTTCCAGTCAACCAGTACCATCTTCCTCCTGGTTGTCAAAACACTACACATTGTTATCGTGAAAAGTATCATATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RALF

Protein Analysis

79

Amino Acids

9.06

Weight (kDa)

9.24

Isoelectric Point (pI)

32.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RALF PF05498 28 - 74 3.2e-06 Rapid ALkalinization Factor (RALF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 72
AclWI GGATC 1 cut(s) 137
AfaI GTAC 1 cut(s) 179
AhlI ACTAGT 1 cut(s) 26
AjnI CCWGG 1 cut(s) 190
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AlwI GGATC 1 cut(s) 137
ApeKI GCWGC 1 cut(s) 5
ArsI GACNNNNNNTTYG 2 cut(s) 141, 173
BccI CCATC 1 cut(s) 189
BciT130I CCWGG 1 cut(s) 192
BcuI ACTAGT 1 cut(s) 26
BfaI CTAG 1 cut(s) 27
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 123
Bse1I ACTGG 2 cut(s) 167, 175
BseBI CCWGG 1 cut(s) 192
BseNI ACTGG 2 cut(s) 167, 175
BsgI GTGCAG 1 cut(s) 118
Bsp143I GATC 1 cut(s) 142
BspACI CCGC 1 cut(s) 72
BspPI GGATC 1 cut(s) 137
BsrI ACTGG 2 cut(s) 167, 175
BssMI GATC 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 192
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstNI CCWGG 1 cut(s) 192
BstSCI CCNGG 1 cut(s) 190
BstX2I RGATCY 1 cut(s) 142
BstYI RGATCY 1 cut(s) 142
Csp6I GTAC 1 cut(s) 178
CviJI RGCY 2 cut(s) 5, 107
CviKI_1 RGCY 2 cut(s) 5, 107
CviQI GTAC 1 cut(s) 178
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 190
FaiI YATR 3 cut(s) 95, 102, 234
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 1 cut(s) 27
GluI GCNGC 1 cut(s) 6
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HinfI GANTC 2 cut(s) 19, 75
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 2 cut(s) 80, 161
Hpy188III TCNNGA 3 cut(s) 128, 140, 221
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 1 cut(s) 77
HpyCH4V TGCA 3 cut(s) 8, 113, 135
Kzo9I GATC 1 cut(s) 142
LpnPI CCDG 5 cut(s) 141, 177, 180, 188, 204
MaeI CTAG 1 cut(s) 27
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 2 cut(s) 99, 176
MflI RGATCY 1 cut(s) 142
MluCI AATT 1 cut(s) 151
MlyI GAGTC 1 cut(s) 28
MnlI CCTC 1 cut(s) 198
MseI TTAA 1 cut(s) 238
MspA1I CMGCKG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 192
MvaI CCWGG 1 cut(s) 192
NdeII GATC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 75
PkrI GCNGC 1 cut(s) 7
PleI GAGTC 1 cut(s) 27
PpsI GAGTC 1 cut(s) 27
Psp6I CCWGG 1 cut(s) 190
PspGI CCWGG 1 cut(s) 190
PsuI RGATCY 1 cut(s) 142
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SaqAI TTAA 1 cut(s) 238
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 142
SchI GAGTC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 192
SetI ASST 1 cut(s) 109
SgeI CNNG 8 cut(s) 39, 140, 152, 179, 187, 203, 204, 233
SmlI CTYRAG 1 cut(s) 138
SmoI CTYRAG 1 cut(s) 138
SpeI ACTAGT 1 cut(s) 26
Sse9I AATT 1 cut(s) 151
SsiI CCGC 1 cut(s) 72
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 190
TasI AATT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 75
Tru1I TTAA 1 cut(s) 238
Tru9I TTAA 1 cut(s) 238
TseI GCWGC 1 cut(s) 5
XcmI CCANNNNNNNNNTGG 1 cut(s) 188
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.