AT1G76230

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
28599678 .. 28600491
814 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G76230.1

Sequence Viewer

Length: 390 bp
ATGGAAAGACAAATCATGGCTTCTTCTAAAAAGGTACAACGGGAAGAGAATACGAAAGAGGAATATTTACCAAACAAGCAAGTTTCAGATGAATCAGAACAACTTGAGAAGAGTTGTTTGACAGAAGAAGAAGATGCGTGTTTGTCTGATGCTAGTCATAGCAGTAAGAAGACGATAAGGGAAGATGCAATTTGTGAATCAAAGAATAGAAAGAAGTATAAGCCAAGCAACGAATCTGGATTCAACACGTTATTTGATGATGACTGGCTTTTTGGTAACAATCAGCAAAAGAATGTTGTTACCACTAATAAAGCCGCTATCAAGAACGATGCAGAGATGATCATGAAGTTGCTGCAGAGATCATGTGGAGATTCCTTGTTTCCTAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.76

Weight (kDa)

5.16

Isoelectric Point (pI)

63.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 315
AfaI GTAC 1 cut(s) 36
AflIII ACRYGT 1 cut(s) 246
AgsI TTSAA 1 cut(s) 244
AluBI AGCT 1 cut(s) 387
AluI AGCT 1 cut(s) 387
ApeKI GCWGC 1 cut(s) 352
ArsI GACNNNNNNTTYG 2 cut(s) 254, 286
BbsI GAAGAC 1 cut(s) 176
BbvI GCAGC 1 cut(s) 339
BclI TGATCA 1 cut(s) 339
BfaI CTAG 2 cut(s) 153, 384
BfmI CTRYAG 1 cut(s) 353
BisI GCNGC 2 cut(s) 315, 353
BlsI GCNGC 2 cut(s) 316, 354
BmsI GCATC 4 cut(s) 124, 139, 175, 319
BpiI GAAGAC 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 269
BseNI ACTGG 1 cut(s) 269
BseXI GCAGC 1 cut(s) 339
Bsp143I GATC 2 cut(s) 339, 359
BspACI CCGC 1 cut(s) 315
BspHI TCATGA 1 cut(s) 342
BspMAI CTGCAG 1 cut(s) 357
BsrI ACTGG 1 cut(s) 269
BssMI GATC 2 cut(s) 339, 359
Bst6I CTCTTC 2 cut(s) 39, 104
BstKTI GATC 2 cut(s) 342, 362
BstMBI GATC 2 cut(s) 339, 359
BstSFI CTRYAG 1 cut(s) 353
BstV1I GCAGC 1 cut(s) 339
BstV2I GAAGAC 1 cut(s) 176
CciI TCATGA 1 cut(s) 342
Csp6I GTAC 1 cut(s) 35
CviAII CATG 3 cut(s) 16, 343, 363
CviJI RGCY 5 cut(s) 20, 223, 268, 314, 387
CviKI_1 RGCY 5 cut(s) 20, 223, 268, 314, 387
CviQI GTAC 1 cut(s) 35
DpnI GATC 2 cut(s) 341, 361
DpnII GATC 2 cut(s) 339, 359
Eam1104I CTCTTC 2 cut(s) 39, 104
EarI CTCTTC 2 cut(s) 39, 104
FaeI CATG 3 cut(s) 19, 346, 366
FaiI YATR 5 cut(s) 17, 159, 219, 344, 364
FatI CATG 3 cut(s) 15, 342, 362
FbaI TGATCA 1 cut(s) 339
Fnu4HI GCNGC 2 cut(s) 315, 353
Fsp4HI GCNGC 2 cut(s) 315, 353
FspBI CTAG 2 cut(s) 153, 384
GluI GCNGC 2 cut(s) 315, 353
Hin1II CATG 3 cut(s) 19, 346, 366
HinfI GANTC 5 cut(s) 92, 197, 233, 240, 371
Hpy188I TCNGA 3 cut(s) 88, 97, 148
Hpy188III TCNNGA 3 cut(s) 237, 322, 343
HpyCH4IV ACGT 1 cut(s) 248
HpyCH4V TGCA 3 cut(s) 188, 332, 355
HpySE526I ACGT 1 cut(s) 248
Hsp92II CATG 3 cut(s) 19, 346, 366
Ksp22I TGATCA 1 cut(s) 339
Kzo9I GATC 2 cut(s) 339, 359
LpnPI CCDG 2 cut(s) 222, 250
Lsp1109I GCAGC 1 cut(s) 339
LweI GCATC 4 cut(s) 124, 139, 175, 319
MaeI CTAG 2 cut(s) 153, 384
MaeII ACGT 1 cut(s) 248
MaeIII GTNAC 2 cut(s) 275, 298
MalI GATC 2 cut(s) 341, 361
MboI GATC 2 cut(s) 339, 359
MboII GAAGA 8 cut(s) 15, 56, 121, 137, 140, 143, 181, 194
MluCI AATT 1 cut(s) 189
MnlI CCTC 1 cut(s) 52
NdeII GATC 2 cut(s) 339, 359
NlaIII CATG 3 cut(s) 19, 346, 366
PagI TCATGA 1 cut(s) 342
PfeI GAWTC 5 cut(s) 92, 197, 233, 240, 371
PkrI GCNGC 2 cut(s) 316, 354
PstI CTGCAG 1 cut(s) 357
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
SatI GCNGC 2 cut(s) 315, 353
Sau3AI GATC 2 cut(s) 339, 359
SetI ASST 3 cut(s) 36, 251, 389
SfaNI GCATC 4 cut(s) 124, 139, 175, 319
SfcI CTRYAG 1 cut(s) 353
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 1 cut(s) 189
SsiI CCGC 1 cut(s) 315
SspI AATATT 1 cut(s) 65
SspMI CTAG 2 cut(s) 153, 384
TaiI ACGT 1 cut(s) 251
TasI AATT 1 cut(s) 189
TauI GCSGC 1 cut(s) 317
TfiI GAWTC 5 cut(s) 92, 197, 233, 240, 371
TseI GCWGC 1 cut(s) 352
TspDTI ATGAA 2 cut(s) 105, 359
XspI CTAG 2 cut(s) 153, 384
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.