AT5G64687

Belongs to the alternative oxidase family

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
25858584 .. 25861909
3326 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G64687.2

Sequence Viewer

Length: 186 bp
ATGAGATTTGCTAGCACGATTACTTTGGGAGAGAAAGCTTCGACTAAGGAGGAGGACGCGAATCAGAGGAAAACAGAGAAGGAATCCACCGGTGGAGACCAAGGAATCGCGAATCAGAGGAAAACAGAGAACGAATCCACCGGTGGAGATCAAGGAATCGCGATAATAAATATCAAAGTTATATAA

Protein Analysis

61

Amino Acids

6.57

Weight (kDa)

5.31

Isoelectric Point (pI)

28.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 3 cut(s) 59, 110, 161
AgeI ACCGGT 2 cut(s) 89, 140
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
Alw26I GTCTC 1 cut(s) 90
AsiGI ACCGGT 2 cut(s) 89, 140
AsuNHI GCTAGC 1 cut(s) 11
BcoDI GTCTC 1 cut(s) 90
BfaI CTAG 1 cut(s) 12
BmtI GCTAGC 1 cut(s) 15
BsaI GGTCTC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 100
BsaWI WCCGGW 2 cut(s) 89, 140
Bse118I RCCGGY 2 cut(s) 89, 140
BseDI CCNNGG 1 cut(s) 100
BseRI GAGGAG 1 cut(s) 65
Bsh1236I CGCG 3 cut(s) 59, 110, 161
BshTI ACCGGT 2 cut(s) 89, 140
BsiSI CCGG 2 cut(s) 90, 141
BsmAI GTCTC 1 cut(s) 90
Bso31I GGTCTC 1 cut(s) 90
Bsp143I GATC 1 cut(s) 148
Bsp68I TCGCGA 2 cut(s) 110, 161
BspFNI CGCG 3 cut(s) 59, 110, 161
BspOI GCTAGC 1 cut(s) 15
BspTNI GGTCTC 1 cut(s) 90
BsrFI RCCGGY 2 cut(s) 89, 140
BssAI RCCGGY 2 cut(s) 89, 140
BssECI CCNNGG 1 cut(s) 100
BssMI GATC 1 cut(s) 148
BssT1I CCWWGG 1 cut(s) 100
BstC8I GCNNGC 1 cut(s) 13
BstDEI CTNAG 1 cut(s) 45
BstFNI CGCG 3 cut(s) 59, 110, 161
BstKTI GATC 1 cut(s) 151
BstMAI GTCTC 1 cut(s) 90
BstMBI GATC 1 cut(s) 148
BstUI CGCG 3 cut(s) 59, 110, 161
BtuMI TCGCGA 2 cut(s) 110, 161
Cac8I GCNNGC 1 cut(s) 13
Cfr10I RCCGGY 2 cut(s) 89, 140
CseI GACGC 1 cut(s) 65
CspAI ACCGGT 2 cut(s) 89, 140
CviJI RGCY 1 cut(s) 38
CviKI_1 RGCY 1 cut(s) 38
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eco130I CCWWGG 1 cut(s) 100
Eco31I GGTCTC 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 100
ErhI CCWWGG 1 cut(s) 100
FaiI YATR 2 cut(s) 182, 184
FspBI CTAG 1 cut(s) 12
HapII CCGG 2 cut(s) 90, 141
HgaI GACGC 1 cut(s) 65
HindIII AAGCTT 1 cut(s) 36
HinfI GANTC 6 cut(s) 61, 83, 105, 112, 134, 156
HpaII CCGG 2 cut(s) 90, 141
Hpy188I TCNGA 2 cut(s) 66, 117
Hpy188III TCNNGA 2 cut(s) 109, 160
HpyAV CCTTC 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 45
Kzo9I GATC 1 cut(s) 148
LpnPI CCDG 2 cut(s) 103, 154
MaeI CTAG 1 cut(s) 12
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MnlI CCTC 4 cut(s) 43, 46, 60, 111
MspI CCGG 2 cut(s) 90, 141
MvnI CGCG 3 cut(s) 59, 110, 161
NdeII GATC 1 cut(s) 148
NheI GCTAGC 1 cut(s) 11
NruI TCGCGA 2 cut(s) 110, 161
PfeI GAWTC 6 cut(s) 61, 83, 105, 112, 134, 156
PinAI ACCGGT 2 cut(s) 89, 140
RruI TCGCGA 2 cut(s) 110, 161
Sau3AI GATC 1 cut(s) 148
SetI ASST 1 cut(s) 40
SgeI CNNG 9 cut(s) 24, 28, 70, 102, 113, 121, 153, 164, 172
SgrAI CRCCGGYG 2 cut(s) 89, 140
SspMI CTAG 1 cut(s) 12
StyI CCWWGG 1 cut(s) 100
TaqI TCGA 1 cut(s) 41
TfiI GAWTC 6 cut(s) 61, 83, 105, 112, 134, 156
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.