Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0003745

Physical Location & Seq

Genomic Coordinates Forward (+)

26351373 .. 26352703

Gene Structure 1331 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT5G65870.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGGTTAAGTTCACAACTTTCCTCTGCATCATCGCTCTTCTTCTCTGCTCCACGCTAACACACGCATCAGCTCGGCTCAATCCAACATCCGTTTATCCAGAAGAAAACTCCTTCAAGAAACTAGAACAGGGAGAGGTAATCTGTGAAGGTGTTGGAGAAGAAGAATGCTTCTTGATACGAAGAACTTTAGTTGCTCACACTGATTACATCTACACTCAAAACCACAATCCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PSK

Protein Analysis

77

Amino Acids

8.75

Weight (kDa)

5.47

Isoelectric Point (pI)

34.38

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PSK	PF06404	41 - 77	6.9e-12	Phytosulfokine precursor protein (PSK)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003745)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G49780 AT5G65870
fragaria_vesca	FvH4_2g03340 FvH4_2g03370 FvH4_2g03370 FvH4_2g32750
malus_domestica	MD05G1105500.v1.1 MD08G1079100.v1.1 MD10G1110000.v1.1 MD15G1066300.v1.1
prunus_persica	Prupe.1G420000_v2.0.a1 Prupe.8G150200_v2.0.a1
pyrus_communis	pycom05g10250 pycom08g06550 pycom10g09530 pycom15g06250
rosa_chinensis	RchiOBHm_Chr6g0248481 RchiOBHm_Chr6g0309921
rosa_multiflora	Rmu_sc0000294.1_g000006 Rmu_sc0002553.1_g000013
rosa_roxburghii	Rroxscaffold_7G00159040 Rroxscaffold_7G00213260
rosa_rugosa	Rorug05G0531600.1 Rorug06G0375900
rosa_samantha	Rh6AG047500 Rh6AG489800 Rh6BG043800 Rh6BG499200 Rh6CG040500 Rh6CG504100 Rh6DG037000 Rh6DG490300
rosa_wichuraiana	Rw6G004120 Rw6G042630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	115
AluBI	AGCT	1 cut(s)	71
AluI	AGCT	1 cut(s)	71
BfaI	CTAG	1 cut(s)	122
BmsI	GCATC	2 cut(s)	36, 74
BseGI	GGATG	1 cut(s)	86
BsmI	GAATGC	1 cut(s)	170
BspQI	GCTCTTC	1 cut(s)	42
Bst6I	CTCTTC	1 cut(s)	42
BstF5I	GGATG	1 cut(s)	86
BtgZI	GCGATG	1 cut(s)	16
BtsCI	GGATG	1 cut(s)	86
BtsIMutI	CAGTG	1 cut(s)	198
CviJI	RGCY	2 cut(s)	71, 76
CviKI_1	RGCY	2 cut(s)	71, 76
Eam1104I	CTCTTC	1 cut(s)	42
EarI	CTCTTC	1 cut(s)	42
FokI	GGATG	1 cut(s)	73
FspBI	CTAG	1 cut(s)	122
Hpy166II	GTNNAC	1 cut(s)	12
Hpy188III	TCNNGA	3 cut(s)	98, 115, 172
Hpy8I	GTNNAC	1 cut(s)	12
HpyAV	CCTTC	2 cut(s)	121, 140
HpyCH4V	TGCA	1 cut(s)	27
LguI	GCTCTTC	1 cut(s)	42
LmnI	GCTCC	1 cut(s)	53
LpnPI	CCDG	2 cut(s)	111, 113
LweI	GCATC	2 cut(s)	36, 74
MaeI	CTAG	1 cut(s)	122
MboII	GAAGA	6 cut(s)	29, 32, 113, 170, 173, 192
MmeI	TCCRAC	2 cut(s)	107, 133
MnlI	CCTC	2 cut(s)	32, 127
MseI	TTAA	1 cut(s)	6
Mva1269I	GAATGC	1 cut(s)	170
NmeAIII	GCCGAG	1 cut(s)	52
PciSI	GCTCTTC	1 cut(s)	42
PctI	GAATGC	1 cut(s)	170
SapI	GCTCTTC	1 cut(s)	42
SaqAI	TTAA	1 cut(s)	6
SetI	ASST	3 cut(s)	73, 138, 151
SfaNI	GCATC	2 cut(s)	36, 74
SgeI	CNNG	8 cut(s)	64, 74, 84, 110, 127, 134, 140, 184
SspMI	CTAG	1 cut(s)	122
Tru1I	TTAA	1 cut(s)	6
Tru9I	TTAA	1 cut(s)	6
TscAI	CASTG	1 cut(s)	205
TspGWI	ACGGA	1 cut(s)	79
TspRI	CASTG	1 cut(s)	205
XspI	CTAG	1 cut(s)	122

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.