FvH4_1g21031

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
13102057 .. 13103021
965 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g21031.t1

Sequence Viewer

Length: 576 bp
ATGGATTCTCAATATTTCAGTTTTTCTACACAAAACTCAGAGCATGAATTTGTTGAAGATTCCTCTCAAACAGCTTCCAAAAGGCCTGCAAGAGGTCTAAGCTTTAACGCAGACGAGGATCGACTCCTTGTCAGTGCTTGGTTGAACATTGGTTTGGATCCTATTCAAGGTAACGAGTGGAAACTTCAAACTTTTTGGGGAAAGATACACGATTACTATCATGAATACAAAACTTTTGATAGTGATCGTTCACAACTAATGTTGATCCAACGATGGAGAAAAATACAAAGGCTGGTGAACAAGTATTCAGGATGTGTAGCTGCTATAAATACATTAAATGAAAGCGGCAAGACTGAACAAGACAAGAAGAAAGAAAGAGATGAAAAGAAACCAGCTATTATGAAGGAGAAAGTTGAAGTTGATAAAGAGAAATTGAGGGTTAGAAAACTTGAGGCTGATAATAAGAAGTTTGAAGTAGAGATGAGAACGATGTCTATGGATACTTCTAAGATGAACCATAAGAAAAGGGCATACTATTCCAAACTACAAATGAAGATTTTGCAGGGTGACAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

192

Amino Acids

22.63

Weight (kDa)

9.21

Isoelectric Point (pI)

44.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 345
AclWI GGATC 4 cut(s) 126, 152, 165, 259
AcsI RAATTY 1 cut(s) 47
AfiI CCNNNNNNNGG 2 cut(s) 92, 167
AgsI TTSAA 6 cut(s) 56, 145, 167, 188, 416, 473
AhdI GACNNNNNGTC 1 cut(s) 128
AjuI GAANNNNNNNTTGG 2 cut(s) 137, 169
AluBI AGCT 4 cut(s) 74, 102, 320, 395
AluI AGCT 4 cut(s) 74, 102, 320, 395
AlwI GGATC 4 cut(s) 126, 152, 165, 259
AoxI GGCC 1 cut(s) 83
ApeKI GCWGC 1 cut(s) 320
ApoI RAATTY 1 cut(s) 47
AsuHPI GGTGA 1 cut(s) 307
BamHI GGATCC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 307
BccI CCATC 1 cut(s) 267
BciVI GTATCC 1 cut(s) 493
BfaI CTAG 1 cut(s) 574
BfuI GTATCC 1 cut(s) 493
BisI GCNGC 2 cut(s) 321, 346
BlsI GCNGC 2 cut(s) 322, 347
BmeRI GACNNNNNGTC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 470
BsaBI GATNNNNATC 2 cut(s) 216, 243
Bsc4I CCNNNNNNNGG 2 cut(s) 92, 167
Bse8I GATNNNNATC 2 cut(s) 216, 243
BseGI GGATG 1 cut(s) 317
BseJI GATNNNNATC 2 cut(s) 216, 243
BseLI CCNNNNNNNGG 2 cut(s) 92, 167
BseMII CTCAG 1 cut(s) 51
BseXI GCAGC 1 cut(s) 307
BshFI GGCC 1 cut(s) 85
BslI CCNNNNNNNGG 2 cut(s) 92, 167
BsnI GGCC 1 cut(s) 85
Bsp143I GATC 4 cut(s) 118, 157, 244, 264
BspACI CCGC 1 cut(s) 345
BspANI GGCC 1 cut(s) 85
BspCNI CTCAG 1 cut(s) 50
BspHI TCATGA 1 cut(s) 220
BspLI GGNNCC 1 cut(s) 159
BspPI GGATC 4 cut(s) 126, 152, 165, 259
BssMI GATC 4 cut(s) 118, 157, 244, 264
BstC8I GCNNGC 1 cut(s) 87
BstDEI CTNAG 3 cut(s) 37, 98, 507
BstENI CCTNNNNNAGG 2 cut(s) 90, 165
BstF5I GGATG 1 cut(s) 317
BstKTI GATC 4 cut(s) 121, 160, 247, 267
BstMBI GATC 4 cut(s) 118, 157, 244, 264
BstV1I GCAGC 1 cut(s) 307
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
BsuI GTATCC 1 cut(s) 493
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 317
BtsIMutI CAGTG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 87
CciI TCATGA 1 cut(s) 220
CviAII CATG 2 cut(s) 44, 221
CviJI RGCY 7 cut(s) 74, 85, 102, 292, 320, 395, 455
CviKI_1 RGCY 7 cut(s) 74, 85, 102, 292, 320, 395, 455
DdeI CTNAG 3 cut(s) 37, 98, 507
DpnI GATC 4 cut(s) 120, 159, 246, 266
DpnII GATC 4 cut(s) 118, 157, 244, 264
DriI GACNNNNNGTC 1 cut(s) 128
Eam1105I GACNNNNNGTC 1 cut(s) 128
Eco147I AGGCCT 1 cut(s) 85
EcoNI CCTNNNNNAGG 2 cut(s) 90, 165
FaeI CATG 2 cut(s) 47, 224
FaiI YATR 7 cut(s) 45, 222, 326, 401, 497, 519, 532
FatI CATG 2 cut(s) 43, 220
Fnu4HI GCNGC 2 cut(s) 321, 346
FokI GGATG 1 cut(s) 324
Fsp4HI GCNGC 2 cut(s) 321, 346
FspBI CTAG 1 cut(s) 574
GluI GCNGC 2 cut(s) 321, 346
HaeIII GGCC 1 cut(s) 85
Hin1II CATG 2 cut(s) 47, 224
HindIII AAGCTT 1 cut(s) 100
HinfI GANTC 3 cut(s) 5, 59, 123
HphI GGTGA 1 cut(s) 307
Hpy166II GTNNAC 2 cut(s) 251, 298
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 2 cut(s) 221, 309
Hpy8I GTNNAC 2 cut(s) 251, 298
HpyAV CCTTC 1 cut(s) 397
HpyCH4V TGCA 2 cut(s) 89, 562
HpyF3I CTNAG 3 cut(s) 37, 98, 507
Hsp92II CATG 2 cut(s) 47, 224
Kzo9I GATC 4 cut(s) 118, 157, 244, 264
LpnPI CCDG 5 cut(s) 99, 278, 294, 405, 548
Lsp1109I GCAGC 1 cut(s) 307
MaeI CTAG 1 cut(s) 574
MaeIII GTNAC 2 cut(s) 170, 566
MalI GATC 4 cut(s) 120, 159, 246, 266
MboI GATC 4 cut(s) 118, 157, 244, 264
MboII GAAGA 3 cut(s) 68, 379, 565
MflI RGATCY 1 cut(s) 157
MluCI AATT 2 cut(s) 47, 431
MlyI GAGTC 1 cut(s) 117
MmeI TCCRAC 1 cut(s) 292
MnlI CCTC 5 cut(s) 73, 86, 109, 429, 445
MseI TTAA 2 cut(s) 105, 335
NdeII GATC 4 cut(s) 118, 157, 244, 264
NlaIII CATG 2 cut(s) 47, 224
NlaIV GGNNCC 1 cut(s) 159
NmuCI GTSAC 1 cut(s) 566
PagI TCATGA 1 cut(s) 220
PceI AGGCCT 1 cut(s) 85
PfeI GAWTC 2 cut(s) 5, 59
PkrI GCNGC 2 cut(s) 322, 347
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
PspN4I GGNNCC 1 cut(s) 159
PsuI RGATCY 1 cut(s) 157
SaqAI TTAA 2 cut(s) 105, 335
SatI GCNGC 2 cut(s) 321, 346
Sau3AI GATC 4 cut(s) 118, 157, 244, 264
SchI GAGTC 1 cut(s) 117
SetI ASST 6 cut(s) 76, 97, 104, 172, 322, 397
SmlI CTYRAG 1 cut(s) 449
SmoI CTYRAG 1 cut(s) 449
Sse9I AATT 2 cut(s) 47, 431
SseBI AGGCCT 1 cut(s) 85
SsiI CCGC 1 cut(s) 345
SspI AATATT 1 cut(s) 14
SspMI CTAG 1 cut(s) 574
StuI AGGCCT 1 cut(s) 85
TaqI TCGA 1 cut(s) 121
TasI AATT 2 cut(s) 47, 431
TauI GCSGC 1 cut(s) 348
TfiI GAWTC 2 cut(s) 5, 59
Tru1I TTAA 2 cut(s) 105, 335
Tru9I TTAA 2 cut(s) 105, 335
TscAI CASTG 1 cut(s) 139
TseFI GTSAC 1 cut(s) 566
TseI GCWGC 1 cut(s) 320
Tsp45I GTSAC 1 cut(s) 566
TspDTI ATGAA 7 cut(s) 60, 237, 354, 396, 416, 527, 566
TspRI CASTG 1 cut(s) 139
XagI CCTNNNNNAGG 2 cut(s) 90, 165
XapI RAATTY 1 cut(s) 47
XspI CTAG 1 cut(s) 574
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.