RchiOBHm_Chr7g0215961

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0006973
Physical Location & Seq
Reverse (-)
33652252 .. 33652683
432 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19322

Sequence Viewer

Length: 300 bp
ATGTCTAGACCACCGGGTAAGAAGGCTGAGAAAAGAAAGCTGAAAGAAACCATTGATCAATTGGTGCAAATACAAAAATTACATCAAGAGAAAAAAGAAAGAGATGAAAAAAAACTGGAGATTATGAAGGAGAAAGTTGAAGTTGACAAGGAGAAACTGCGAGTTAGGAAACTTGAGGCTGAGAATAGGAAATTTGAGGCTGAGATGAAAATTATGTCTATGGATACATCAACTATGAATCCTGAGCAGAGGGCATATTATTCCAAACTTCAGATGAAAATTCTCCAAGGTGATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

99

Amino Acids

11.91

Weight (kDa)

9.6

Isoelectric Point (pI)

33.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 2 - 94 1.3e-10 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 191, 279
AcuI CTGAAG 1 cut(s) 254
AgsI TTSAA 1 cut(s) 140
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
ApoI RAATTY 2 cut(s) 191, 279
AsuC2I CCSGG 1 cut(s) 15
BciVI GTATCC 1 cut(s) 217
BclI TGATCA 1 cut(s) 55
BcnI CCSGG 1 cut(s) 15
BfaI CTAG 1 cut(s) 6
BfuI GTATCC 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 15
BpmI CTGGAG 1 cut(s) 137
Bpu10I CCTNAGC 1 cut(s) 243
BpuEI CTTGAG 1 cut(s) 194
BpuMI CCSGG 1 cut(s) 15
BsaJI CCNNGG 1 cut(s) 286
Bse1I ACTGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 286
BseMII CTCAG 4 cut(s) 18, 171, 192, 234
BseNI ACTGG 1 cut(s) 120
BsiSI CCGG 1 cut(s) 14
Bsp143I GATC 1 cut(s) 55
BspCNI CTCAG 4 cut(s) 19, 172, 193, 235
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 286
BssMI GATC 1 cut(s) 55
BssT1I CCWWGG 1 cut(s) 286
BstDEI CTNAG 4 cut(s) 27, 180, 201, 243
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 13
BsuI GTATCC 1 cut(s) 217
CviJI RGCY 4 cut(s) 26, 40, 179, 200
CviKI_1 RGCY 4 cut(s) 26, 40, 179, 200
DdeI CTNAG 4 cut(s) 27, 180, 201, 243
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
Eco130I CCWWGG 1 cut(s) 286
Eco57I CTGAAG 1 cut(s) 254
EcoT14I CCWWGG 1 cut(s) 286
ErhI CCWWGG 1 cut(s) 286
FaiI YATR 7 cut(s) 125, 215, 221, 236, 256, 296, 298
FbaI TGATCA 1 cut(s) 55
FspBI CTAG 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 137
HapII CCGG 1 cut(s) 14
HincII GTYRAC 1 cut(s) 145
HindII GTYRAC 1 cut(s) 145
HinfI GANTC 1 cut(s) 238
HpaII CCGG 1 cut(s) 14
Hpy166II GTNNAC 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 273
Hpy188III TCNNGA 3 cut(s) 6, 86, 242
Hpy8I GTNNAC 1 cut(s) 145
HpyAV CCTTC 2 cut(s) 16, 121
HpyCH4V TGCA 1 cut(s) 67
HpyF3I CTNAG 4 cut(s) 27, 180, 201, 243
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 1 cut(s) 55
LpnPI CCDG 3 cut(s) 27, 101, 255
MaeI CTAG 1 cut(s) 6
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MfeI CAATTG 1 cut(s) 59
MluCI AATT 5 cut(s) 59, 77, 191, 210, 279
MnlI CCTC 3 cut(s) 169, 190, 243
MspI CCGG 1 cut(s) 14
MspR9I CCNGG 1 cut(s) 15
MunI CAATTG 1 cut(s) 59
NciI CCSGG 1 cut(s) 15
NdeII GATC 1 cut(s) 55
PfeI GAWTC 1 cut(s) 238
Sau3AI GATC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 15
SetI ASST 2 cut(s) 42, 292
SgeI CNNG 9 cut(s) 18, 26, 27, 98, 128, 160, 173, 185, 254
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 5 cut(s) 59, 77, 191, 210, 279
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 13
StyI CCWWGG 1 cut(s) 286
TasI AATT 5 cut(s) 59, 77, 191, 210, 279
TfiI GAWTC 1 cut(s) 238
TspDTI ATGAA 5 cut(s) 120, 140, 221, 251, 290
XapI RAATTY 2 cut(s) 191, 279
XbaI TCTAGA 1 cut(s) 5
XcmI CCANNNNNNNNNTGG 1 cut(s) 58
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.