Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003073.1

Orthogroup ID

OG0006973

Physical Location & Seq

Genomic Coordinates Reverse (-)

36568 .. 37074

Gene Structure 507 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003073.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 507 bp

atgtttgaagcacaagaaaagcttcagttcaatcttgatcatgcttggattttgttgaagcaccaaccaaagtggatacaattaatgcaagagctggacagcaagaaaagtaagcaaagatctaagtcttgtataactaatatctcatcatcttcaactacaggccctgtcatagatattgaagaagacacgtacacttgctttccagtgtctagaccaccgggtaagaaggctaagaaaagaaagcttaaagaaaccactgatcaattggtgcaaatacaaaaattacatcaagagaaaaaagaaggagatgaaaagaaactagaaattataaaggagaaagttgaagttgacaaggagaaaccacgagttaggaaacttgaggttgagaacagaaaatttgaggctgagatgagaattatgtctatggatacatctactatgaatcctaagcagagggcatattattccaaacttcagatgaaaattttgcaaggtgatatatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAM-associated

Protein Analysis

168

Amino Acids

19.81

Weight (kDa)

9.44

Isoelectric Point (pI)

42.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006973)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g21031 FvH4_4g19882 FvH4_5g29683 FvH4_6g38382
malus_domestica	MD07G1026100.v1.1
prunus_persica	Prupe.1G172500_v2.0.a1 Prupe.1G279700_v2.0.a1
pyrus_communis	pycom07g01990
rosa_chinensis	RchiOBHm_Chr2g0117811 RchiOBHm_Chr6g0270241 RchiOBHm_Chr7g0215961
rosa_multiflora	Rmu_sc0001477.1_g000012 Rmu_sc0002693.1_g000005 Rmu_sc0003073.1_g000010
rosa_roxburghii	Rroxscaffold_1G00049230 Rroxscaffold_4G00327030
rosa_rugosa	Rorug03G0186700 Rorug05G0239600 Rorug06G0145300
rosa_wichuraiana	Rw1G019540 Rw1G026630 Rw2G015000 Rw2G052400 Rw6G033100 Rw7G038420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	332
AcsI	RAATTY	2 cut(s)	398, 486
AcuI	CTGAAG	2 cut(s)	8, 461
AfaI	GTAC	1 cut(s)	194
AflIII	ACRYGT	1 cut(s)	189
AgsI	TTSAA	6 cut(s)	8, 31, 58, 156, 182, 347
AluBI	AGCT	3 cut(s)	22, 94, 247
AluI	AGCT	3 cut(s)	22, 94, 247
AlwNI	CAGNNNCTG	1 cut(s)	167
AoxI	GGCC	1 cut(s)	163
ApoI	RAATTY	2 cut(s)	398, 486
AseI	ATTAAT	1 cut(s)	83
Asp700I	GAANNNNTTC	1 cut(s)	21
AspS9I	GGNCC	1 cut(s)	164
AsuC2I	CCSGG	1 cut(s)	222
BauI	CACGAG	1 cut(s)	366
BbsI	GAAGAC	1 cut(s)	192
BciVI	GTATCC	2 cut(s)	69, 424
BclI	TGATCA	2 cut(s)	37, 262
BcnI	CCSGG	1 cut(s)	222
BfaI	CTAG	2 cut(s)	213, 323
BfmI	CTRYAG	1 cut(s)	159
BfuI	GTATCC	2 cut(s)	69, 424
BglII	AGATCT	1 cut(s)	119
Bme1390I	CCNGG	1 cut(s)	222
BmgT120I	GGNCC	1 cut(s)	164
BmrFI	CCNGG	1 cut(s)	222
BpiI	GAAGAC	1 cut(s)	192
Bpu10I	CCTNAGC	1 cut(s)	450
BpuEI	CTTGAG	1 cut(s)	401
BpuMI	CCSGG	1 cut(s)	222
BsaAI	YACGTR	1 cut(s)	192
Bse1I	ACTGG	1 cut(s)	206
BseMII	CTCAG	1 cut(s)	399
BseNI	ACTGG	1 cut(s)	206
BshFI	GGCC	1 cut(s)	165
BsiSI	CCGG	1 cut(s)	221
BsnI	GGCC	1 cut(s)	165
Bsp143I	GATC	3 cut(s)	37, 119, 262
BspANI	GGCC	1 cut(s)	165
BspCNI	CTCAG	1 cut(s)	400
BsrI	ACTGG	1 cut(s)	206
BssMI	GATC	3 cut(s)	37, 119, 262
BssSI	CACGAG	1 cut(s)	366
Bst2BI	CACGAG	1 cut(s)	366
BstBAI	YACGTR	1 cut(s)	192
BstDEI	CTNAG	4 cut(s)	123, 234, 408, 450
BstKTI	GATC	3 cut(s)	40, 122, 265
BstMBI	GATC	3 cut(s)	37, 119, 262
BstSCI	CCNGG	1 cut(s)	220
BstSFI	CTRYAG	1 cut(s)	159
BstV2I	GAAGAC	1 cut(s)	192
BstX2I	RGATCY	1 cut(s)	119
BstYI	RGATCY	1 cut(s)	119
BsuI	GTATCC	2 cut(s)	69, 424
BsuRI	GGCC	1 cut(s)	165
BtsIMutI	CAGTG	2 cut(s)	213, 258
CaiI	CAGNNNCTG	1 cut(s)	167
Cfr13I	GGNCC	1 cut(s)	164
Csp6I	GTAC	1 cut(s)	193
CspCI	CAANNNNNGTGG	2 cut(s)	53, 88
CviAII	CATG	1 cut(s)	41
CviJI	RGCY	6 cut(s)	22, 94, 165, 233, 247, 407
CviKI_1	RGCY	6 cut(s)	22, 94, 165, 233, 247, 407
CviQI	GTAC	1 cut(s)	193
DdeI	CTNAG	4 cut(s)	123, 234, 408, 450
DpnI	GATC	3 cut(s)	39, 121, 264
DpnII	GATC	3 cut(s)	37, 119, 262
Eco57I	CTGAAG	2 cut(s)	8, 461
EcoO109I	RGGNCCY	1 cut(s)	164
FaeI	CATG	1 cut(s)	44
FalI	AAGNNNNNCTT	1 cut(s)	38
FatI	CATG	1 cut(s)	40
FbaI	TGATCA	2 cut(s)	37, 262
FspBI	CTAG	2 cut(s)	213, 323
HaeIII	GGCC	1 cut(s)	165
HapII	CCGG	1 cut(s)	221
Hin1II	CATG	1 cut(s)	44
HincII	GTYRAC	1 cut(s)	352
HindII	GTYRAC	1 cut(s)	352
HindIII	AAGCTT	2 cut(s)	20, 245
HinfI	GANTC	1 cut(s)	445
HpaII	CCGG	1 cut(s)	221
Hpy166II	GTNNAC	2 cut(s)	195, 352
Hpy188I	TCNGA	1 cut(s)	480
Hpy188III	TCNNGA	3 cut(s)	35, 213, 293
Hpy8I	GTNNAC	2 cut(s)	195, 352
HpyAV	CCTTC	2 cut(s)	223, 299
HpyCH4IV	ACGT	1 cut(s)	191
HpyCH4V	TGCA	3 cut(s)	88, 274, 493
HpyF3I	CTNAG	4 cut(s)	123, 234, 408, 450
HpySE526I	ACGT	1 cut(s)	191
Hsp92II	CATG	1 cut(s)	44
Ksp22I	TGATCA	2 cut(s)	37, 262
Kzo9I	GATC	3 cut(s)	37, 119, 262
LpnPI	CCDG	5 cut(s)	80, 147, 180, 219, 234
MaeI	CTAG	2 cut(s)	213, 323
MaeII	ACGT	1 cut(s)	191
MalI	GATC	3 cut(s)	39, 121, 264
MboI	GATC	3 cut(s)	37, 119, 262
MboII	GAAGA	3 cut(s)	144, 194, 197
MfeI	CAATTG	1 cut(s)	266
MflI	RGATCY	1 cut(s)	119
MluCI	AATT	7 cut(s)	80, 266, 284, 327, 398, 417, 486
MnlI	CCTC	3 cut(s)	376, 397, 450
MroXI	GAANNNNTTC	1 cut(s)	21
MseI	TTAA	2 cut(s)	83, 249
MspI	CCGG	1 cut(s)	221
MspR9I	CCNGG	1 cut(s)	222
MunI	CAATTG	1 cut(s)	266
NciI	CCSGG	1 cut(s)	222
NdeII	GATC	3 cut(s)	37, 119, 262
NlaIII	CATG	1 cut(s)	44
PdmI	GAANNNNTTC	1 cut(s)	21
PfeI	GAWTC	1 cut(s)	445
Ppu21I	YACGTR	1 cut(s)	192
PshBI	ATTAAT	1 cut(s)	83
PsiI	TTATAA	1 cut(s)	332
PspPI	GGNCC	1 cut(s)	164
PstNI	CAGNNNCTG	1 cut(s)	167
PsuI	RGATCY	1 cut(s)	119
RsaI	GTAC	1 cut(s)	194
RsaNI	GTAC	1 cut(s)	193
SaqAI	TTAA	2 cut(s)	83, 249
Sau3AI	GATC	3 cut(s)	37, 119, 262
Sau96I	GGNCC	1 cut(s)	164
ScrFI	CCNGG	1 cut(s)	222
SetI	ASST	6 cut(s)	24, 96, 194, 249, 387, 499
SfcI	CTRYAG	1 cut(s)	159
SmlI	CTYRAG	1 cut(s)	380
SmoI	CTYRAG	1 cut(s)	380
Sse9I	AATT	7 cut(s)	80, 266, 284, 327, 398, 417, 486
SspMI	CTAG	2 cut(s)	213, 323
StyD4I	CCNGG	1 cut(s)	220
TaiI	ACGT	1 cut(s)	194
TasI	AATT	7 cut(s)	80, 266, 284, 327, 398, 417, 486
TfiI	GAWTC	1 cut(s)	445
Tru1I	TTAA	2 cut(s)	83, 249
Tru9I	TTAA	2 cut(s)	83, 249
TscAI	CASTG	2 cut(s)	213, 265
TspDTI	ATGAA	3 cut(s)	327, 458, 497
TspRI	CASTG	2 cut(s)	213, 265
VspI	ATTAAT	1 cut(s)	83
XapI	RAATTY	2 cut(s)	398, 486
XbaI	TCTAGA	1 cut(s)	212
XcmI	CCANNNNNNNNNTGG	1 cut(s)	265
XmnI	GAANNNNTTC	1 cut(s)	21
XspI	CTAG	2 cut(s)	213, 323

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.