Rmu_sc0002693.1_g000005

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002693.1
Physical Location & Seq
Reverse (-)
9076 .. 9582
507 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002693.1_g000005.1.cds

Sequence Viewer

Length: 507 bp
atgtttgaagcacaagaaaagagaaggttcacacttgatcatgcttggattttgttaaggcaccaaccaaagtggatacaactaatgcaagagctggacagcaagaaaagtaagcaaagatctaaaccttctataactaatatctcatcatcttcaactaccggcactcacatagttattgaagaagaagaaaacacttgctttctagtggctagaccaccgggtaagaaggctgagaaaagaaagttgaaagaaacaactgatcaattggtggaaataaaaaaattacagcaagagaaaaaagaaagagatgaaaaaaaactagaaattatgaaggagaaaattgaagttgacaaggagaaactgcgagttaggaaacttgaggctgagaataggaaaattgaggctgagatgagaattatgtctatggatacatctactatgaatccggagcaaagggcatattattccaaacttcaaatgaaaattttgcaaggtgatatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

168

Amino Acids

19.99

Weight (kDa)

9.48

Isoelectric Point (pI)

60.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 60
AccIII TCCGGA 1 cut(s) 448
AcsI RAATTY 1 cut(s) 486
AgsI TTSAA 6 cut(s) 8, 156, 182, 250, 347, 479
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Aor13HI TCCGGA 1 cut(s) 448
ApoI RAATTY 1 cut(s) 486
AsuC2I CCSGG 1 cut(s) 222
BanI GGYRCC 1 cut(s) 60
BciVI GTATCC 2 cut(s) 69, 424
BclI TGATCA 2 cut(s) 37, 262
BcnI CCSGG 1 cut(s) 222
BfaI CTAG 3 cut(s) 206, 213, 323
BfuI GTATCC 2 cut(s) 69, 424
BglII AGATCT 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 222
BmiI GGNNCC 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 222
BpuEI CTTGAG 1 cut(s) 401
BpuMI CCSGG 1 cut(s) 222
BsaWI WCCGGW 1 cut(s) 448
Bse118I RCCGGY 1 cut(s) 161
BseAI TCCGGA 1 cut(s) 448
BseMII CTCAG 3 cut(s) 225, 378, 399
BshNI GGYRCC 1 cut(s) 60
BsiSI CCGG 3 cut(s) 162, 221, 449
Bsp13I TCCGGA 1 cut(s) 448
Bsp143I GATC 3 cut(s) 37, 119, 262
BspCNI CTCAG 3 cut(s) 226, 379, 400
BspEI TCCGGA 1 cut(s) 448
BspLI GGNNCC 1 cut(s) 62
BspT107I GGYRCC 1 cut(s) 60
BsrFI RCCGGY 1 cut(s) 161
BssAI RCCGGY 1 cut(s) 161
BssMI GATC 3 cut(s) 37, 119, 262
BstDEI CTNAG 3 cut(s) 234, 387, 408
BstKTI GATC 3 cut(s) 40, 122, 265
BstMBI GATC 3 cut(s) 37, 119, 262
BstSCI CCNGG 1 cut(s) 220
BstX2I RGATCY 1 cut(s) 119
BstYI RGATCY 1 cut(s) 119
BsuI GTATCC 2 cut(s) 69, 424
Cfr10I RCCGGY 1 cut(s) 161
CspCI CAANNNNNGTGG 2 cut(s) 53, 88
CviAII CATG 1 cut(s) 41
CviJI RGCY 5 cut(s) 94, 212, 233, 386, 407
CviKI_1 RGCY 5 cut(s) 94, 212, 233, 386, 407
DdeI CTNAG 3 cut(s) 234, 387, 408
DpnI GATC 3 cut(s) 39, 121, 264
DpnII GATC 3 cut(s) 37, 119, 262
FaeI CATG 1 cut(s) 44
FatI CATG 1 cut(s) 40
FbaI TGATCA 2 cut(s) 37, 262
FspBI CTAG 3 cut(s) 206, 213, 323
HapII CCGG 3 cut(s) 162, 221, 449
Hin1II CATG 1 cut(s) 44
HincII GTYRAC 1 cut(s) 352
HindII GTYRAC 1 cut(s) 352
HinfI GANTC 1 cut(s) 445
HpaII CCGG 3 cut(s) 162, 221, 449
Hpy166II GTNNAC 2 cut(s) 30, 352
Hpy188III TCNNGA 1 cut(s) 449
Hpy8I GTNNAC 2 cut(s) 30, 352
HpyAV CCTTC 4 cut(s) 18, 138, 223, 328
HpyCH4V TGCA 2 cut(s) 88, 493
HpyF3I CTNAG 3 cut(s) 234, 387, 408
Hsp92II CATG 1 cut(s) 44
Kpn2I TCCGGA 1 cut(s) 448
Ksp22I TGATCA 2 cut(s) 37, 262
Kzo9I GATC 3 cut(s) 37, 119, 262
LmnI GCTCC 1 cut(s) 451
LpnPI CCDG 4 cut(s) 80, 175, 234, 462
MaeI CTAG 3 cut(s) 206, 213, 323
MalI GATC 3 cut(s) 39, 121, 264
MboI GATC 3 cut(s) 37, 119, 262
MboII GAAGA 4 cut(s) 144, 194, 197, 200
MfeI CAATTG 1 cut(s) 266
MflI RGATCY 1 cut(s) 119
MluCI AATT 7 cut(s) 266, 284, 327, 342, 399, 417, 486
MnlI CCTC 2 cut(s) 376, 397
MroI TCCGGA 1 cut(s) 448
MseI TTAA 1 cut(s) 56
MspI CCGG 3 cut(s) 162, 221, 449
MspR9I CCNGG 1 cut(s) 222
MunI CAATTG 1 cut(s) 266
NciI CCSGG 1 cut(s) 222
NdeII GATC 3 cut(s) 37, 119, 262
NlaIII CATG 1 cut(s) 44
NlaIV GGNNCC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 445
PspN4I GGNNCC 1 cut(s) 62
PsuI RGATCY 1 cut(s) 119
SaqAI TTAA 1 cut(s) 56
Sau3AI GATC 3 cut(s) 37, 119, 262
ScrFI CCNGG 1 cut(s) 222
SetI ASST 4 cut(s) 29, 96, 130, 499
SmlI CTYRAG 1 cut(s) 380
SmoI CTYRAG 1 cut(s) 380
Sse9I AATT 7 cut(s) 266, 284, 327, 342, 399, 417, 486
SspMI CTAG 3 cut(s) 206, 213, 323
StyD4I CCNGG 1 cut(s) 220
TasI AATT 7 cut(s) 266, 284, 327, 342, 399, 417, 486
TfiI GAWTC 1 cut(s) 445
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TspDTI ATGAA 4 cut(s) 327, 347, 458, 497
XapI RAATTY 1 cut(s) 486
XspI CTAG 3 cut(s) 206, 213, 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.