Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0006973

Physical Location & Seq

Genomic Coordinates Reverse (-)

30111327 .. 30111699

Gene Structure 373 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ49069

Sequence Viewer

CDS Protein Promoter (2k)

Length: 177 bp

ATGAAGGAGAAAGTTGAAGTTGACAAGGAGAAACTGCGAGTTAGGAAACTTGAGGCTGAGAATAGGAAATTTGAGGCTGAGATGAAAATTATGTCTATGGATACATCAACTATGAATCCTGAGCAGAGGGCATATTATTCCAAACTTCAGATGAAAATTCTCCAAGGTGATATATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAM-associated

Protein Analysis

58

Amino Acids

6.97

Weight (kDa)

9.0

Isoelectric Point (pI)

27.81

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
NAM-associated	PF14303	6 - 53	2.9e-06	No apical meristem-associated C-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006973)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g21031 FvH4_4g19882 FvH4_5g29683 FvH4_6g38382
malus_domestica	MD07G1026100.v1.1
prunus_persica	Prupe.1G172500_v2.0.a1 Prupe.1G279700_v2.0.a1
pyrus_communis	pycom07g01990
rosa_chinensis	RchiOBHm_Chr2g0117811 RchiOBHm_Chr6g0270241 RchiOBHm_Chr7g0215961
rosa_multiflora	Rmu_sc0001477.1_g000012 Rmu_sc0002693.1_g000005 Rmu_sc0003073.1_g000010
rosa_roxburghii	Rroxscaffold_1G00049230 Rroxscaffold_4G00327030
rosa_rugosa	Rorug03G0186700 Rorug05G0239600 Rorug06G0145300
rosa_wichuraiana	Rw1G019540 Rw1G026630 Rw2G015000 Rw2G052400 Rw6G033100 Rw7G038420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	68, 156
AcuI	CTGAAG	1 cut(s)	131
AgsI	TTSAA	1 cut(s)	17
ApoI	RAATTY	2 cut(s)	68, 156
BciVI	GTATCC	1 cut(s)	94
BfuI	GTATCC	1 cut(s)	94
Bpu10I	CCTNAGC	1 cut(s)	120
BpuEI	CTTGAG	1 cut(s)	71
BsaJI	CCNNGG	1 cut(s)	163
BseDI	CCNNGG	1 cut(s)	163
BseMII	CTCAG	3 cut(s)	48, 69, 111
BspCNI	CTCAG	3 cut(s)	49, 70, 112
BssECI	CCNNGG	1 cut(s)	163
BssT1I	CCWWGG	1 cut(s)	163
BstDEI	CTNAG	3 cut(s)	57, 78, 120
BsuI	GTATCC	1 cut(s)	94
CviJI	RGCY	2 cut(s)	56, 77
CviKI_1	RGCY	2 cut(s)	56, 77
DdeI	CTNAG	3 cut(s)	57, 78, 120
Eco130I	CCWWGG	1 cut(s)	163
Eco57I	CTGAAG	1 cut(s)	131
EcoT14I	CCWWGG	1 cut(s)	163
ErhI	CCWWGG	1 cut(s)	163
FaiI	YATR	6 cut(s)	92, 98, 113, 133, 173, 175
HincII	GTYRAC	1 cut(s)	22
HindII	GTYRAC	1 cut(s)	22
HinfI	GANTC	1 cut(s)	115
Hpy166II	GTNNAC	1 cut(s)	22
Hpy188I	TCNGA	1 cut(s)	150
Hpy188III	TCNNGA	1 cut(s)	119
Hpy8I	GTNNAC	1 cut(s)	22
HpyF3I	CTNAG	3 cut(s)	57, 78, 120
LpnPI	CCDG	1 cut(s)	132
MluCI	AATT	3 cut(s)	68, 87, 156
MnlI	CCTC	3 cut(s)	46, 67, 120
PfeI	GAWTC	1 cut(s)	115
SetI	ASST	1 cut(s)	169
SgeI	CNNG	4 cut(s)	37, 50, 62, 131
SmlI	CTYRAG	1 cut(s)	50
SmoI	CTYRAG	1 cut(s)	50
Sse9I	AATT	3 cut(s)	68, 87, 156
StyI	CCWWGG	1 cut(s)	163
TasI	AATT	3 cut(s)	68, 87, 156
TfiI	GAWTC	1 cut(s)	115
TspDTI	ATGAA	4 cut(s)	17, 98, 128, 167
XapI	RAATTY	2 cut(s)	68, 156

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.