Rroxscaffold_4G00327030

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0006973
Physical Location & Seq
Reverse (-)
59435236 .. 59436423
1188 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00327030.1

Sequence Viewer

Length: 333 bp
ATGTTTGAAGCACAAGAAAAGATTCGGTTCAATCTTGATCATGCTTGGATTTTGTTAAGGCACCAACCAAAGTGGATACAACTAATGCAAGAGCTGGACATCAAGAAAAGTAAGCCAAGATCTAAATCTTCTATAACTAATATCTCATCATCTTCAACTACAAGCACTCACATAGATATAGAAGAAGGCACGAACACTTGCTTTCCAATGTCTAGACCACCAGGTAAAAAGGCTGAGAAAAGAAAGCTGAAAGAAACCACGATCAATTGGTGCAAATACAAAAATTACATCAAGAGAAAAAAGAAAGAGATGAAAAAAAACTGGAGATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

110

Amino Acids

13.19

Weight (kDa)

10.13

Isoelectric Point (pI)

49.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 10 - 105 2e-13 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 60
AgsI TTSAA 3 cut(s) 8, 31, 156
AjnI CCWGG 1 cut(s) 220
AluBI AGCT 2 cut(s) 94, 247
AluI AGCT 2 cut(s) 94, 247
Asp700I GAANNNNTTC 1 cut(s) 21
BanI GGYRCC 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 222
BciVI GTATCC 1 cut(s) 69
BclI TGATCA 1 cut(s) 37
BfaI CTAG 1 cut(s) 213
BfuI GTATCC 1 cut(s) 69
BglII AGATCT 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 222
BmiI GGNNCC 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 222
BsaBI GATNNNNATC 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 326
Bse8I GATNNNNATC 1 cut(s) 124
BseBI CCWGG 1 cut(s) 222
BseJI GATNNNNATC 1 cut(s) 124
BseMII CTCAG 1 cut(s) 225
BseNI ACTGG 1 cut(s) 326
BshNI GGYRCC 1 cut(s) 60
Bsp143I GATC 3 cut(s) 37, 119, 261
BspCNI CTCAG 1 cut(s) 226
BspLI GGNNCC 1 cut(s) 62
BspT107I GGYRCC 1 cut(s) 60
BsrI ACTGG 1 cut(s) 326
BssMI GATC 3 cut(s) 37, 119, 261
Bst2UI CCWGG 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 234
BstKTI GATC 3 cut(s) 40, 122, 264
BstMBI GATC 3 cut(s) 37, 119, 261
BstNI CCWGG 1 cut(s) 222
BstSCI CCNGG 1 cut(s) 220
BstX2I RGATCY 1 cut(s) 119
BstYI RGATCY 1 cut(s) 119
BsuI GTATCC 1 cut(s) 69
CsiI ACCWGGT 1 cut(s) 220
CspCI CAANNNNNGTGG 2 cut(s) 53, 88
CviAII CATG 1 cut(s) 41
CviJI RGCY 4 cut(s) 94, 115, 233, 247
CviKI_1 RGCY 4 cut(s) 94, 115, 233, 247
DdeI CTNAG 1 cut(s) 234
DpnI GATC 3 cut(s) 39, 121, 263
DpnII GATC 3 cut(s) 37, 119, 261
EcoRII CCWGG 1 cut(s) 220
FaeI CATG 1 cut(s) 44
FaiI YATR 5 cut(s) 42, 134, 173, 179, 331
FatI CATG 1 cut(s) 40
FbaI TGATCA 1 cut(s) 37
FspBI CTAG 1 cut(s) 213
Hin1II CATG 1 cut(s) 44
HinfI GANTC 1 cut(s) 22
Hpy188III TCNNGA 4 cut(s) 35, 103, 213, 292
HpyAV CCTTC 1 cut(s) 179
HpyCH4V TGCA 2 cut(s) 88, 273
HpyF3I CTNAG 1 cut(s) 234
Hsp92II CATG 1 cut(s) 44
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 3 cut(s) 37, 119, 261
LpnPI CCDG 4 cut(s) 80, 207, 234, 307
MabI ACCWGGT 1 cut(s) 220
MaeI CTAG 1 cut(s) 213
MalI GATC 3 cut(s) 39, 121, 263
MboI GATC 3 cut(s) 37, 119, 261
MboII GAAGA 3 cut(s) 120, 144, 194
MfeI CAATTG 1 cut(s) 265
MflI RGATCY 1 cut(s) 119
MluCI AATT 2 cut(s) 265, 283
MroXI GAANNNNTTC 1 cut(s) 21
MseI TTAA 1 cut(s) 56
MspR9I CCNGG 1 cut(s) 222
MunI CAATTG 1 cut(s) 265
MvaI CCWGG 1 cut(s) 222
NdeII GATC 3 cut(s) 37, 119, 261
NlaIII CATG 1 cut(s) 44
NlaIV GGNNCC 1 cut(s) 62
PdmI GAANNNNTTC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 220
PspGI CCWGG 1 cut(s) 220
PspN4I GGNNCC 1 cut(s) 62
PsuI RGATCY 1 cut(s) 119
SaqAI TTAA 1 cut(s) 56
Sau3AI GATC 3 cut(s) 37, 119, 261
ScrFI CCNGG 1 cut(s) 222
SetI ASST 3 cut(s) 96, 226, 249
SexAI ACCWGGT 1 cut(s) 220
Sse9I AATT 2 cut(s) 265, 283
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 220
TasI AATT 2 cut(s) 265, 283
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TspDTI ATGAA 1 cut(s) 326
XbaI TCTAGA 1 cut(s) 212
XmnI GAANNNNTTC 1 cut(s) 21
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.