FvH4_1g23532

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
15388240 .. 15388571
332 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g23532.t1

Sequence Viewer

Length: 321 bp
ATGATGCTAGATATCAAACCTGTTGCAGAATTGGCTAAGAGGCTAAACCAAGAACACCAACAGGTTCTTGTCATGGTAGAAAAACCAGAGGCCGCTGTTGCAGACTTGCCCGACCAAGAGAAAAGGCCTCCTTTCCCTTTTCCTTTTCCTTGCTGGTTATGCAACAAAACTGATCATGTCTATCTCAAATGCCCCAACCGAGACACACTCACAAAGATGGCTCAAGAATTCATGGAGAAGCAGCGTCTTTATTGCATGATATGCGCCGACAATACTGATCATCGCACTAGAGATTGCCCAAATGAAAATGGATTCGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.42

Weight (kDa)

5.88

Isoelectric Point (pI)

49.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 93
AcsI RAATTY 1 cut(s) 227
Alw26I GTCTC 1 cut(s) 195
AoxI GGCC 2 cut(s) 90, 125
ApeKI GCWGC 1 cut(s) 241
ApoI RAATTY 1 cut(s) 227
AspLEI GCGC 1 cut(s) 266
BbvI GCAGC 1 cut(s) 253
BccI CCATC 1 cut(s) 211
BclI TGATCA 2 cut(s) 172, 277
BcoDI GTCTC 1 cut(s) 195
BfaI CTAG 2 cut(s) 8, 288
BisI GCNGC 2 cut(s) 93, 242
BlsI GCNGC 2 cut(s) 94, 243
BplI GAGNNNNNCTC 2 cut(s) 192, 224
BpuEI CTTGAG 1 cut(s) 207
BseXI GCAGC 1 cut(s) 253
BshFI GGCC 2 cut(s) 92, 127
BsmAI GTCTC 1 cut(s) 195
BsnI GGCC 2 cut(s) 92, 127
Bsp143I GATC 2 cut(s) 172, 277
BspACI CCGC 1 cut(s) 93
BspANI GGCC 2 cut(s) 92, 127
BssMI GATC 2 cut(s) 172, 277
BstAPI GCANNNNNTGC 1 cut(s) 261
BstDEI CTNAG 1 cut(s) 36
BstHHI GCGC 1 cut(s) 266
BstKTI GATC 2 cut(s) 175, 280
BstMAI GTCTC 1 cut(s) 195
BstMBI GATC 2 cut(s) 172, 277
BstMWI GCNNNNNNNGC 4 cut(s) 32, 98, 159, 261
BstV1I GCAGC 1 cut(s) 253
BsuRI GGCC 2 cut(s) 92, 127
BtgZI GCGATG 1 cut(s) 266
CfoI GCGC 1 cut(s) 266
CseI GACGC 1 cut(s) 233
CviAII CATG 4 cut(s) 73, 176, 232, 256
CviJI RGCY 5 cut(s) 35, 43, 92, 127, 221
CviKI_1 RGCY 5 cut(s) 35, 43, 92, 127, 221
DdeI CTNAG 1 cut(s) 36
DpnI GATC 2 cut(s) 174, 279
DpnII GATC 2 cut(s) 172, 277
Eco147I AGGCCT 1 cut(s) 127
Eco32I GATATC 1 cut(s) 13
EcoRI GAATTC 1 cut(s) 227
EcoRV GATATC 1 cut(s) 13
FaeI CATG 4 cut(s) 76, 179, 235, 259
FaiI YATR 7 cut(s) 74, 160, 177, 233, 257, 262, 319
FalI AAGNNNNNCTT 2 cut(s) 115, 147
FatI CATG 4 cut(s) 72, 175, 231, 255
FbaI TGATCA 2 cut(s) 172, 277
Fnu4HI GCNGC 2 cut(s) 93, 242
Fsp4HI GCNGC 2 cut(s) 93, 242
FspBI CTAG 2 cut(s) 8, 288
GlaI GCGC 1 cut(s) 265
GluI GCNGC 2 cut(s) 93, 242
HaeIII GGCC 2 cut(s) 92, 127
HgaI GACGC 1 cut(s) 233
HhaI GCGC 1 cut(s) 266
Hin1II CATG 4 cut(s) 76, 179, 235, 259
Hin6I GCGC 1 cut(s) 264
HinP1I GCGC 1 cut(s) 264
HinfI GANTC 1 cut(s) 312
Hpy188III TCNNGA 1 cut(s) 224
HpyCH4V TGCA 4 cut(s) 26, 101, 162, 255
HpyF10VI GCNNNNNNNGC 4 cut(s) 32, 98, 159, 261
HpyF3I CTNAG 1 cut(s) 36
Hsp92II CATG 4 cut(s) 76, 179, 235, 259
HspAI GCGC 1 cut(s) 264
Ksp22I TGATCA 2 cut(s) 172, 277
Kzo9I GATC 2 cut(s) 172, 277
LpnPI CCDG 4 cut(s) 33, 47, 99, 139
Lsp1109I GCAGC 1 cut(s) 253
MaeI CTAG 2 cut(s) 8, 288
MalI GATC 2 cut(s) 174, 279
MboI GATC 2 cut(s) 172, 277
MluCI AATT 2 cut(s) 29, 227
MnlI CCTC 3 cut(s) 33, 82, 138
MslI CAYNNNNRTG 1 cut(s) 215
MspA1I CMGCKG 1 cut(s) 95
MwoI GCNNNNNNNGC 4 cut(s) 32, 98, 159, 261
NdeII GATC 2 cut(s) 172, 277
NlaIII CATG 4 cut(s) 76, 179, 235, 259
PceI AGGCCT 1 cut(s) 127
PfeI GAWTC 1 cut(s) 312
PkrI GCNGC 2 cut(s) 94, 243
RseI CAYNNNNRTG 1 cut(s) 215
SatI GCNGC 2 cut(s) 93, 242
Sau3AI GATC 2 cut(s) 172, 277
SetI ASST 2 cut(s) 22, 66
SmiMI CAYNNNNRTG 1 cut(s) 215
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
Sse9I AATT 2 cut(s) 29, 227
SseBI AGGCCT 1 cut(s) 127
SsiI CCGC 1 cut(s) 93
SspMI CTAG 2 cut(s) 8, 288
StuI AGGCCT 1 cut(s) 127
TasI AATT 2 cut(s) 29, 227
TauI GCSGC 1 cut(s) 95
TfiI GAWTC 1 cut(s) 312
TseI GCWGC 1 cut(s) 241
TspDTI ATGAA 2 cut(s) 220, 318
XapI RAATTY 1 cut(s) 227
XspI CTAG 2 cut(s) 8, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.