FvH4_3g01190

Belongs to the plant LTP family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
583050 .. 583881
832 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g01190.t1

Sequence Viewer

Length: 366 bp
ATGGCGAACAAAATGGCTTCGCTTTTGATTCTTGCCTTTGCGCTTATGGTTGTCGCCCTCAATGCTTCCCTCGCAAATGGGGACATCACATGTCAAGCTGCCATATTAGATTTGATGCCATGTCAGTCTTACTTGGCAAGCTTTGGTCCGCCAACCCCTACCGTCCCTTGCTGTGATGGTGTTCGAAGTGTGGACGCTCAAGCTACCACCACAGAGATTCGTAGAAGCCTCTGTGAATGCTTTAAGAAGGCTGCTGCTGGCATGCCTATAGACCCTGCAAAACTTAAGCAGCTTCCTCAGTTCTGTCAAGTCTCTGTTCCTGTTCCTCTTGACCCCAGCATCGACTGTAGCAAGATTTCATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

12.78

Weight (kDa)

6.07

Isoelectric Point (pI)

57.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 15 - 108 6.2e-09 Probable lipid transfer
Tryp_alpha_amyl PF00234 31 - 116 5.4e-10 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AflII CTTAAG 1 cut(s) 284
AflIII ACRYGT 1 cut(s) 89
AluBI AGCT 4 cut(s) 98, 141, 203, 292
AluI AGCT 4 cut(s) 98, 141, 203, 292
Alw26I GTCTC 1 cut(s) 316
ApeKI GCWGC 4 cut(s) 98, 251, 254, 289
AspLEI GCGC 1 cut(s) 43
AspS9I GGNCC 1 cut(s) 146
AsuII TTCGAA 1 cut(s) 184
AvaII GGWCC 1 cut(s) 146
BbvI GCAGC 4 cut(s) 85, 238, 241, 301
BccI CCATC 1 cut(s) 170
BcoDI GTCTC 1 cut(s) 316
BfmI CTRYAG 2 cut(s) 267, 346
BfrI CTTAAG 1 cut(s) 284
BisI GCNGC 4 cut(s) 99, 252, 255, 290
BlsI GCNGC 4 cut(s) 100, 253, 256, 291
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 146
BmsI GCATC 2 cut(s) 105, 348
Bpu14I TTCGAA 1 cut(s) 184
BpuEI CTTGAG 1 cut(s) 183
BseMII CTCAG 1 cut(s) 311
BseXI GCAGC 4 cut(s) 85, 238, 241, 301
BseYI CCCAGC 1 cut(s) 335
BslFI GGGAC 2 cut(s) 95, 149
BsmAI GTCTC 1 cut(s) 316
BsmFI GGGAC 2 cut(s) 95, 149
BsmI GAATGC 1 cut(s) 242
Bsp119I TTCGAA 1 cut(s) 184
BspACI CCGC 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 310
BspT104I TTCGAA 1 cut(s) 184
BspTI CTTAAG 1 cut(s) 284
Bst4CI ACNGT 2 cut(s) 163, 347
BstAFI CTTAAG 1 cut(s) 284
BstBI TTCGAA 1 cut(s) 184
BstC8I GCNNGC 3 cut(s) 139, 259, 263
BstDEI CTNAG 1 cut(s) 297
BstHHI GCGC 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 316
BstMWI GCNNNNNNNGC 2 cut(s) 62, 71
BstNSI RCATGY 2 cut(s) 93, 265
BstSFI CTRYAG 2 cut(s) 267, 346
BstV1I GCAGC 4 cut(s) 85, 238, 241, 301
Cac8I GCNNGC 3 cut(s) 139, 259, 263
CfoI GCGC 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 146
CseI GACGC 1 cut(s) 203
CviAII CATG 3 cut(s) 90, 120, 262
CviJI RGCY 7 cut(s) 17, 98, 141, 203, 228, 251, 292
CviKI_1 RGCY 7 cut(s) 17, 98, 141, 203, 228, 251, 292
DdeI CTNAG 1 cut(s) 297
EciI GGCGGA 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 146
FaeI CATG 3 cut(s) 93, 123, 265
FaiI YATR 6 cut(s) 47, 91, 104, 121, 263, 269
FaqI GGGAC 2 cut(s) 95, 149
FatI CATG 3 cut(s) 89, 119, 261
Fnu4HI GCNGC 4 cut(s) 99, 252, 255, 290
Fsp4HI GCNGC 4 cut(s) 99, 252, 255, 290
GlaI GCGC 1 cut(s) 42
GluI GCNGC 4 cut(s) 99, 252, 255, 290
GsaI CCCAGC 1 cut(s) 339
HgaI GACGC 1 cut(s) 203
HhaI GCGC 1 cut(s) 43
Hin1II CATG 3 cut(s) 93, 123, 265
Hin6I GCGC 1 cut(s) 41
HinP1I GCGC 1 cut(s) 41
HindIII AAGCTT 1 cut(s) 139
HinfI GANTC 2 cut(s) 28, 217
Hpy166II GTNNAC 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 329
Hpy8I GTNNAC 1 cut(s) 193
HpyAV CCTTC 1 cut(s) 241
HpyCH4III ACNGT 2 cut(s) 163, 347
HpyCH4V TGCA 1 cut(s) 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 62, 71
HpyF3I CTNAG 1 cut(s) 297
Hsp92II CATG 3 cut(s) 93, 123, 265
HspAI GCGC 1 cut(s) 41
LpnPI CCDG 4 cut(s) 243, 288, 333, 349
Lsp1109I GCAGC 4 cut(s) 85, 238, 241, 301
LweI GCATC 2 cut(s) 105, 348
MnlI CCTC 5 cut(s) 68, 80, 239, 306, 336
MseI TTAA 3 cut(s) 243, 285, 364
MspCI CTTAAG 1 cut(s) 284
Mva1269I GAATGC 1 cut(s) 242
MwoI GCNNNNNNNGC 2 cut(s) 62, 71
NlaIII CATG 3 cut(s) 93, 123, 265
NspI RCATGY 2 cut(s) 93, 265
NspV TTCGAA 1 cut(s) 184
PaeI GCATGC 1 cut(s) 265
PciI ACATGT 1 cut(s) 89
PctI GAATGC 1 cut(s) 242
PfeI GAWTC 2 cut(s) 28, 217
PkrI GCNGC 4 cut(s) 100, 253, 256, 291
PscI ACATGT 1 cut(s) 89
PspFI CCCAGC 1 cut(s) 335
PspPI GGNCC 1 cut(s) 146
SaqAI TTAA 3 cut(s) 243, 285, 364
SatI GCNGC 4 cut(s) 99, 252, 255, 290
Sau96I GGNCC 1 cut(s) 146
SetI ASST 4 cut(s) 100, 143, 205, 294
SfaNI GCATC 2 cut(s) 105, 348
SfcI CTRYAG 2 cut(s) 267, 346
SfuI TTCGAA 1 cut(s) 184
SinI GGWCC 1 cut(s) 146
SmlI CTYRAG 2 cut(s) 198, 284
SmoI CTYRAG 2 cut(s) 198, 284
SphI GCATGC 1 cut(s) 265
SsiI CCGC 1 cut(s) 149
TaaI ACNGT 2 cut(s) 163, 347
TaqI TCGA 2 cut(s) 184, 342
TfiI GAWTC 2 cut(s) 28, 217
Tru1I TTAA 3 cut(s) 243, 285, 364
Tru9I TTAA 3 cut(s) 243, 285, 364
TseI GCWGC 4 cut(s) 98, 251, 254, 289
TspDTI ATGAA 1 cut(s) 348
Vha464I CTTAAG 1 cut(s) 284
VpaK11BI GGWCC 1 cut(s) 146
XceI RCATGY 2 cut(s) 93, 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.