Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr3

Orthogroup ID

OG0004839

Physical Location & Seq

Genomic Coordinates Forward (+)

62837967 .. 62838538

Gene Structure 572 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000015189

Sequence Viewer

CDS Protein Promoter (2k)

Length: 366 bp

ATGACTAGCTGCTGGTCTCTCTTGGCTTTTGGTATTGTGATCATGGTGTTGATGATCAGTCCATATCCTGCAAATGGCCTCACATGCGATGAGACCGCAGGCATTTTGAATCCCTGTCAAGATTTTTTGGTTGGAAATGGCCCTCCAACTCCTAGCGCTTCCTGCTGTGGAGCTGTGAAAGAATTGGTTTCTAAAGTTACATCCAGACAAGTACGTAGAGATCTGTGTGAATGTATGAAGCAGATTATTCTTGCCTTTCATATTGACGTCGGAAAACTTCAATACATCATTCCTCAGTATTGCAAGGTCACAATTCCTGTACCTCTTGATCCCAACGCAGACTGCAGCAAGGCTTCTCTGTTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LTP_2 Tryp_alpha_amyl

Protein Analysis

122

Amino Acids

13.1

Weight (kDa)

6.51

Isoelectric Point (pI)

43.12

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LTP_2	PF14368	18 - 106	2.7e-08	Probable lipid transfer
Tryp_alpha_amyl	PF00234	29 - 115	7.9e-07	Protease inhibitor/seed storage/LTP family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004839)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g02840 FvH4_3g01190
malus_domestica	MD10G1328900.v1.1
prunus_persica	Prupe.4G013200_v2.0.a1 Prupe.4G217000_v2.0.a1
pyrus_communis	pycom10g27860
rosa_chinensis	RchiOBHm_Chr5g0047311 RchiOBHm_Chr5g0075671 RchiOBHm_Chr6g0247621
rosa_laevigata	RLG00000015189 RLG00000034489
rosa_multiflora	Rmu_sc0000580.1_g000125 Rmu_sc0003092.1_g000052 Rmu_sc0003441.1_g000086
rosa_roxburghii	Rroxscaffold_1G00034040 Rroxscaffold_7G00213830
rosa_rugosa	Rorug05G0235600 Rorug05G0527600
rosa_samantha	Rh5AG314700 Rh5DG334200 Rh6AG040900 Rh6AG041200 Rh6AG041900 Rh6BG036300 Rh6BG036500 Rh6BG036800 Rh6CG036200
rosa_wichuraiana	Rw5G029420 Rw5G046240 Rw6G003590 Rw6G003610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	270
AciI	CCGC	1 cut(s)	96
AclWI	GGATC	1 cut(s)	323
AcyI	GRCGYC	1 cut(s)	267
AfaI	GTAC	2 cut(s)	213, 321
AfeI	AGCGCT	1 cut(s)	157
AfiI	CCNNNNNNNGG	1 cut(s)	74
AgsI	TTSAA	2 cut(s)	109, 281
AluBI	AGCT	2 cut(s)	9, 173
AluI	AGCT	2 cut(s)	9, 173
Alw26I	GTCTC	2 cut(s)	21, 86
AlwI	GGATC	1 cut(s)	323
Aor51HI	AGCGCT	1 cut(s)	157
AoxI	GGCC	2 cut(s)	76, 139
ApeKI	GCWGC	2 cut(s)	9, 345
AspLEI	GCGC	1 cut(s)	158
AspS9I	GGNCC	1 cut(s)	140
BbvI	GCAGC	1 cut(s)	357
BclI	TGATCA	2 cut(s)	39, 54
BcoDI	GTCTC	2 cut(s)	21, 86
BfaI	CTAG	2 cut(s)	6, 153
BfmI	CTRYAG	1 cut(s)	343
BfoI	RGCGCY	1 cut(s)	159
BglII	AGATCT	1 cut(s)	220
BisI	GCNGC	2 cut(s)	10, 346
BlsI	GCNGC	2 cut(s)	11, 347
BmgT120I	GGNCC	1 cut(s)	140
BsaAI	YACGTR	1 cut(s)	215
BsaHI	GRCGYC	1 cut(s)	267
BsaI	GGTCTC	2 cut(s)	21, 86
Bsc4I	CCNNNNNNNGG	1 cut(s)	74
BseGI	GGATG	1 cut(s)	200
BseLI	CCNNNNNNNGG	1 cut(s)	74
BseMII	CTCAG	1 cut(s)	308
BseXI	GCAGC	1 cut(s)	357
BshFI	GGCC	2 cut(s)	78, 141
BslI	CCNNNNNNNGG	1 cut(s)	74
BsmAI	GTCTC	2 cut(s)	21, 86
BsnI	GGCC	2 cut(s)	78, 141
Bso31I	GGTCTC	2 cut(s)	21, 86
Bsp143I	GATC	4 cut(s)	39, 54, 220, 328
BspACI	CCGC	1 cut(s)	96
BspANI	GGCC	2 cut(s)	78, 141
BspCNI	CTCAG	1 cut(s)	307
BspMAI	CTGCAG	1 cut(s)	347
BspPI	GGATC	1 cut(s)	323
BspTNI	GGTCTC	2 cut(s)	21, 86
BssMI	GATC	4 cut(s)	39, 54, 220, 328
BssNI	GRCGYC	1 cut(s)	267
BstACI	GRCGYC	1 cut(s)	267
BstBAI	YACGTR	1 cut(s)	215
BstC8I	GCNNGC	1 cut(s)	100
BstDEI	CTNAG	1 cut(s)	294
BstF5I	GGATG	1 cut(s)	200
BstH2I	RGCGCY	1 cut(s)	159
BstHHI	GCGC	1 cut(s)	158
BstKTI	GATC	4 cut(s)	42, 57, 223, 331
BstMAI	GTCTC	2 cut(s)	21, 86
BstMBI	GATC	4 cut(s)	39, 54, 220, 328
BstMWI	GCNNNNNNNGC	2 cut(s)	84, 162
BstNSI	RCATGY	1 cut(s)	87
BstSFI	CTRYAG	1 cut(s)	343
BstSNI	TACGTA	1 cut(s)	215
BstV1I	GCAGC	1 cut(s)	357
BstX2I	RGATCY	1 cut(s)	220
BstYI	RGATCY	1 cut(s)	220
BsuRI	GGCC	2 cut(s)	78, 141
BtgZI	GCGATG	1 cut(s)	102
BtsCI	GGATG	1 cut(s)	200
Cac8I	GCNNGC	1 cut(s)	100
CfoI	GCGC	1 cut(s)	158
Cfr13I	GGNCC	1 cut(s)	140
Csp6I	GTAC	2 cut(s)	212, 320
CviAII	CATG	2 cut(s)	43, 84
CviJI	RGCY	6 cut(s)	9, 26, 78, 141, 173, 353
CviKI_1	RGCY	6 cut(s)	9, 26, 78, 141, 173, 353
CviQI	GTAC	2 cut(s)	212, 320
DdeI	CTNAG	1 cut(s)	294
DpnI	GATC	4 cut(s)	41, 56, 222, 330
DpnII	GATC	4 cut(s)	39, 54, 220, 328
Eco105I	TACGTA	1 cut(s)	215
Eco31I	GGTCTC	2 cut(s)	21, 86
Eco47III	AGCGCT	1 cut(s)	157
FaeI	CATG	2 cut(s)	46, 87
FaiI	YATR	5 cut(s)	44, 64, 85, 236, 261
FatI	CATG	2 cut(s)	42, 83
FbaI	TGATCA	2 cut(s)	39, 54
Fnu4HI	GCNGC	2 cut(s)	10, 346
FokI	GGATG	1 cut(s)	187
Fsp4HI	GCNGC	2 cut(s)	10, 346
FspBI	CTAG	2 cut(s)	6, 153
GlaI	GCGC	1 cut(s)	157
GluI	GCNGC	2 cut(s)	10, 346
HaeII	RGCGCY	1 cut(s)	159
HaeIII	GGCC	2 cut(s)	78, 141
HhaI	GCGC	1 cut(s)	158
Hin1I	GRCGYC	1 cut(s)	267
Hin1II	CATG	2 cut(s)	46, 87
Hin6I	GCGC	1 cut(s)	156
HinP1I	GCGC	1 cut(s)	156
HinfI	GANTC	1 cut(s)	109
Hpy188I	TCNGA	1 cut(s)	272
Hpy188III	TCNNGA	3 cut(s)	119, 204, 326
Hpy99I	CGWCG	1 cut(s)	272
HpyCH4IV	ACGT	2 cut(s)	214, 267
HpyCH4V	TGCA	3 cut(s)	71, 303, 345
HpyF10VI	GCNNNNNNNGC	2 cut(s)	84, 162
HpyF3I	CTNAG	1 cut(s)	294
HpySE526I	ACGT	2 cut(s)	214, 267
Hsp92I	GRCGYC	1 cut(s)	267
Hsp92II	CATG	2 cut(s)	46, 87
HspAI	GCGC	1 cut(s)	156
Ksp22I	TGATCA	2 cut(s)	39, 54
Kzo9I	GATC	4 cut(s)	39, 54, 220, 328
LmnI	GCTCC	1 cut(s)	170
LpnPI	CCDG	6 cut(s)	81, 84, 127, 175, 217, 330
Lsp1109I	GCAGC	1 cut(s)	357
MaeI	CTAG	2 cut(s)	6, 153
MaeII	ACGT	2 cut(s)	214, 267
MaeIII	GTNAC	2 cut(s)	196, 307
MalI	GATC	4 cut(s)	41, 56, 222, 330
MboI	GATC	4 cut(s)	39, 54, 220, 328
MflI	RGATCY	1 cut(s)	220
MluCI	AATT	2 cut(s)	182, 312
MmeI	TCCRAC	3 cut(s)	112, 170, 250
MnlI	CCTC	4 cut(s)	89, 153, 303, 333
MseI	TTAA	1 cut(s)	364
MwoI	GCNNNNNNNGC	2 cut(s)	84, 162
NdeII	GATC	4 cut(s)	39, 54, 220, 328
NlaIII	CATG	2 cut(s)	46, 87
NmuCI	GTSAC	1 cut(s)	307
NspI	RCATGY	1 cut(s)	87
PfeI	GAWTC	1 cut(s)	109
PkrI	GCNGC	2 cut(s)	11, 347
Ppu21I	YACGTR	1 cut(s)	215
PspPI	GGNCC	1 cut(s)	140
PstI	CTGCAG	1 cut(s)	347
PsuI	RGATCY	1 cut(s)	220
RsaI	GTAC	2 cut(s)	213, 321
RsaNI	GTAC	2 cut(s)	212, 320
SaqAI	TTAA	1 cut(s)	364
SatI	GCNGC	2 cut(s)	10, 346
Sau3AI	GATC	4 cut(s)	39, 54, 220, 328
Sau96I	GGNCC	1 cut(s)	140
SetI	ASST	6 cut(s)	11, 175, 217, 270, 309, 325
SfcI	CTRYAG	1 cut(s)	343
SnaBI	TACGTA	1 cut(s)	215
Sse9I	AATT	2 cut(s)	182, 312
SsiI	CCGC	1 cut(s)	96
SspMI	CTAG	2 cut(s)	6, 153
TaiI	ACGT	2 cut(s)	217, 270
TasI	AATT	2 cut(s)	182, 312
TfiI	GAWTC	1 cut(s)	109
Tru1I	TTAA	1 cut(s)	364
Tru9I	TTAA	1 cut(s)	364
TseFI	GTSAC	1 cut(s)	307
TseI	GCWGC	2 cut(s)	9, 345
Tsp45I	GTSAC	1 cut(s)	307
TspDTI	ATGAA	2 cut(s)	248, 251
XceI	RCATGY	1 cut(s)	87
XspI	CTAG	2 cut(s)	6, 153
ZraI	GACGTC	1 cut(s)	268

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.