Rroxscaffold_7G00213830

Belongs to the plant LTP family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0004839
Physical Location & Seq
Forward (+)
64287253 .. 64287627
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00213830.1

Sequence Viewer

Length: 375 bp
ATGACTAGCTGCTGGTCTCTCTTGGCTTTTGGTATTGTGATCATGGTGTTGATGATCAGTCCATATCCTGCAAATGGCCTCACATGCGATGAGACCGCAGGCATTTTGAATCCCTGTCAAGATTTTTTGGTTGGAAATGGCCCTCCAACTCCTAGCGCTTCTTGCTGTGGAGCTGTGAAAGAATTGGTTTCTAAAGTTACATCCAGACAAGTACGTGGAGATCTGTGTGAATGTATGAAGCAGATTATTCTTGCCTTTCATATTGACGTCGGAAAACTTCAATACATCATTCCTCAATTGCCTTTCACAATTTCTGTACCTCTTGATCCCAACGCAGACTGCAGCAAGTACGCAATTTTTTTCTCTTCAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2 Tryp_alpha_amyl

Protein Analysis

124

Amino Acids

13.36

Weight (kDa)

5.07

Isoelectric Point (pI)

44.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 18 - 80 1.3e-06 Probable lipid transfer
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 270
AciI CCGC 1 cut(s) 96
AclWI GGATC 1 cut(s) 320
AcyI GRCGYC 1 cut(s) 267
AfaI GTAC 3 cut(s) 213, 318, 350
AfeI AGCGCT 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 3 cut(s) 109, 281, 369
AluBI AGCT 2 cut(s) 9, 173
AluI AGCT 2 cut(s) 9, 173
Alw26I GTCTC 2 cut(s) 21, 86
AlwI GGATC 1 cut(s) 320
Aor51HI AGCGCT 1 cut(s) 157
AoxI GGCC 2 cut(s) 76, 139
ApeKI GCWGC 2 cut(s) 9, 342
AspLEI GCGC 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 140
BbvI GCAGC 1 cut(s) 354
BclI TGATCA 2 cut(s) 39, 54
BcoDI GTCTC 2 cut(s) 21, 86
BfaI CTAG 2 cut(s) 6, 153
BfmI CTRYAG 1 cut(s) 340
BfoI RGCGCY 1 cut(s) 159
BglII AGATCT 1 cut(s) 220
BisI GCNGC 2 cut(s) 10, 343
BlsI GCNGC 2 cut(s) 11, 344
BmgT120I GGNCC 1 cut(s) 140
BsaAI YACGTR 1 cut(s) 215
BsaHI GRCGYC 1 cut(s) 267
BsaI GGTCTC 2 cut(s) 21, 86
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseGI GGATG 1 cut(s) 200
BseLI CCNNNNNNNGG 1 cut(s) 74
BseXI GCAGC 1 cut(s) 354
BshFI GGCC 2 cut(s) 78, 141
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 2 cut(s) 21, 86
BsnI GGCC 2 cut(s) 78, 141
Bso31I GGTCTC 2 cut(s) 21, 86
Bsp143I GATC 4 cut(s) 39, 54, 220, 325
BspACI CCGC 1 cut(s) 96
BspANI GGCC 2 cut(s) 78, 141
BspMAI CTGCAG 1 cut(s) 344
BspPI GGATC 1 cut(s) 320
BspTNI GGTCTC 2 cut(s) 21, 86
BssMI GATC 4 cut(s) 39, 54, 220, 325
BssNI GRCGYC 1 cut(s) 267
Bst6I CTCTTC 1 cut(s) 370
BstACI GRCGYC 1 cut(s) 267
BstBAI YACGTR 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 100
BstF5I GGATG 1 cut(s) 200
BstH2I RGCGCY 1 cut(s) 159
BstHHI GCGC 1 cut(s) 158
BstKTI GATC 4 cut(s) 42, 57, 223, 328
BstMAI GTCTC 2 cut(s) 21, 86
BstMBI GATC 4 cut(s) 39, 54, 220, 325
BstMWI GCNNNNNNNGC 2 cut(s) 84, 162
BstNSI RCATGY 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 340
BstV1I GCAGC 1 cut(s) 354
BstX2I RGATCY 1 cut(s) 220
BstYI RGATCY 1 cut(s) 220
BsuRI GGCC 2 cut(s) 78, 141
BtgZI GCGATG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 200
Cac8I GCNNGC 1 cut(s) 100
CfoI GCGC 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 140
Csp6I GTAC 3 cut(s) 212, 317, 349
CviAII CATG 2 cut(s) 43, 84
CviJI RGCY 5 cut(s) 9, 26, 78, 141, 173
CviKI_1 RGCY 5 cut(s) 9, 26, 78, 141, 173
CviQI GTAC 3 cut(s) 212, 317, 349
DpnI GATC 4 cut(s) 41, 56, 222, 327
DpnII GATC 4 cut(s) 39, 54, 220, 325
Eam1104I CTCTTC 1 cut(s) 370
EarI CTCTTC 1 cut(s) 370
Eco31I GGTCTC 2 cut(s) 21, 86
Eco47III AGCGCT 1 cut(s) 157
FaeI CATG 2 cut(s) 46, 87
FaiI YATR 5 cut(s) 44, 64, 85, 236, 261
FatI CATG 2 cut(s) 42, 83
FbaI TGATCA 2 cut(s) 39, 54
Fnu4HI GCNGC 2 cut(s) 10, 343
FokI GGATG 1 cut(s) 187
Fsp4HI GCNGC 2 cut(s) 10, 343
FspBI CTAG 2 cut(s) 6, 153
GlaI GCGC 1 cut(s) 157
GluI GCNGC 2 cut(s) 10, 343
HaeII RGCGCY 1 cut(s) 159
HaeIII GGCC 2 cut(s) 78, 141
HhaI GCGC 1 cut(s) 158
Hin1I GRCGYC 1 cut(s) 267
Hin1II CATG 2 cut(s) 46, 87
Hin6I GCGC 1 cut(s) 156
HinP1I GCGC 1 cut(s) 156
HinfI GANTC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 272
Hpy188III TCNNGA 3 cut(s) 119, 204, 323
Hpy99I CGWCG 1 cut(s) 272
HpyCH4IV ACGT 2 cut(s) 214, 267
HpyCH4V TGCA 2 cut(s) 71, 342
HpyF10VI GCNNNNNNNGC 2 cut(s) 84, 162
HpySE526I ACGT 2 cut(s) 214, 267
Hsp92I GRCGYC 1 cut(s) 267
Hsp92II CATG 2 cut(s) 46, 87
HspAI GCGC 1 cut(s) 156
Ksp22I TGATCA 2 cut(s) 39, 54
Kzo9I GATC 4 cut(s) 39, 54, 220, 325
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 4 cut(s) 81, 84, 127, 217
Lsp1109I GCAGC 1 cut(s) 354
MaeI CTAG 2 cut(s) 6, 153
MaeII ACGT 2 cut(s) 214, 267
MaeIII GTNAC 1 cut(s) 196
MalI GATC 4 cut(s) 41, 56, 222, 327
MboI GATC 4 cut(s) 39, 54, 220, 325
MboII GAAGA 1 cut(s) 357
MfeI CAATTG 1 cut(s) 296
MflI RGATCY 1 cut(s) 220
MluCI AATT 5 cut(s) 182, 296, 309, 354, 370
MmeI TCCRAC 3 cut(s) 112, 170, 250
MnlI CCTC 4 cut(s) 89, 153, 303, 330
MseI TTAA 1 cut(s) 373
MunI CAATTG 1 cut(s) 296
MwoI GCNNNNNNNGC 2 cut(s) 84, 162
NdeII GATC 4 cut(s) 39, 54, 220, 325
NlaIII CATG 2 cut(s) 46, 87
NspI RCATGY 1 cut(s) 87
PfeI GAWTC 1 cut(s) 109
PkrI GCNGC 2 cut(s) 11, 344
Ppu21I YACGTR 1 cut(s) 215
PspPI GGNCC 1 cut(s) 140
PstI CTGCAG 1 cut(s) 344
PsuI RGATCY 1 cut(s) 220
RsaI GTAC 3 cut(s) 213, 318, 350
RsaNI GTAC 3 cut(s) 212, 317, 349
SaqAI TTAA 1 cut(s) 373
SatI GCNGC 2 cut(s) 10, 343
Sau3AI GATC 4 cut(s) 39, 54, 220, 325
Sau96I GGNCC 1 cut(s) 140
SetI ASST 5 cut(s) 11, 175, 217, 270, 322
SfcI CTRYAG 1 cut(s) 340
Sse9I AATT 5 cut(s) 182, 296, 309, 354, 370
SsiI CCGC 1 cut(s) 96
SspMI CTAG 2 cut(s) 6, 153
TaiI ACGT 2 cut(s) 217, 270
TasI AATT 5 cut(s) 182, 296, 309, 354, 370
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 1 cut(s) 373
Tru9I TTAA 1 cut(s) 373
TseI GCWGC 2 cut(s) 9, 342
TspDTI ATGAA 2 cut(s) 248, 251
XceI RCATGY 1 cut(s) 87
XspI CTAG 2 cut(s) 6, 153
ZraI GACGTC 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.