Rh6BG036300

Belongs to the plant LTP family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
6035016 .. 6035393
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG036300.1

Sequence Viewer

Length: 378 bp
ATGACTAGCTGCTGGTCTCTCTTGGCTTTTGGTATTGTGATCATGGTGTTGATGATAAGTCCATATCCTGCAAATGGCCTCACATGTGATGAGACCGCAGGCATTTTGAATCCCTGTCAAGATTTTTTGGTTGGAAATGGCCCTCCAACTCCTAGCGCTTCTTGCTGTGGAGCTGTGAAAGAATTGGTTTCTAAAGTTACATCCAGACAAGTACGTAGAGATCTGTGTGAATGTATGAAGCAGATTATTCTTGCCTTTCATATTGACGTCGGAAAACTTCAATACATCATTCCTCAGTATTGCAAGGTCACAATTCCTGTACCTCTTGATCCCAACGCAAACTGTAGCAAGTACGCAATTTTTTTCTCTTCAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

13.61

Weight (kDa)

7.47

Isoelectric Point (pI)

45.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 19 - 106 3e-08 Probable lipid transfer
Tryp_alpha_amyl PF00234 29 - 114 1.4e-06 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 270
AciI CCGC 1 cut(s) 96
AclWI GGATC 1 cut(s) 323
AcyI GRCGYC 1 cut(s) 267
AfaI GTAC 3 cut(s) 213, 321, 353
AfeI AGCGCT 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 74
AflIII ACRYGT 1 cut(s) 83
AgsI TTSAA 3 cut(s) 109, 281, 372
AluBI AGCT 2 cut(s) 9, 173
AluI AGCT 2 cut(s) 9, 173
Alw26I GTCTC 2 cut(s) 21, 86
AlwI GGATC 1 cut(s) 323
Aor51HI AGCGCT 1 cut(s) 157
AoxI GGCC 2 cut(s) 76, 139
ApeKI GCWGC 1 cut(s) 9
AspLEI GCGC 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 140
BclI TGATCA 1 cut(s) 39
BcoDI GTCTC 2 cut(s) 21, 86
BfaI CTAG 2 cut(s) 6, 153
BfmI CTRYAG 1 cut(s) 343
BfoI RGCGCY 1 cut(s) 159
BglII AGATCT 1 cut(s) 220
BisI GCNGC 1 cut(s) 10
BlsI GCNGC 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 140
BsaAI YACGTR 1 cut(s) 215
BsaHI GRCGYC 1 cut(s) 267
BsaI GGTCTC 2 cut(s) 21, 86
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseGI GGATG 1 cut(s) 200
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 308
BshFI GGCC 2 cut(s) 78, 141
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 2 cut(s) 21, 86
BsnI GGCC 2 cut(s) 78, 141
Bso31I GGTCTC 2 cut(s) 21, 86
Bsp143I GATC 3 cut(s) 39, 220, 328
BspACI CCGC 1 cut(s) 96
BspANI GGCC 2 cut(s) 78, 141
BspCNI CTCAG 1 cut(s) 307
BspPI GGATC 1 cut(s) 323
BspTNI GGTCTC 2 cut(s) 21, 86
BssMI GATC 3 cut(s) 39, 220, 328
BssNI GRCGYC 1 cut(s) 267
Bst4CI ACNGT 1 cut(s) 344
Bst6I CTCTTC 1 cut(s) 373
BstACI GRCGYC 1 cut(s) 267
BstBAI YACGTR 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 1 cut(s) 200
BstH2I RGCGCY 1 cut(s) 159
BstHHI GCGC 1 cut(s) 158
BstKTI GATC 3 cut(s) 42, 223, 331
BstMAI GTCTC 2 cut(s) 21, 86
BstMBI GATC 3 cut(s) 39, 220, 328
BstMWI GCNNNNNNNGC 1 cut(s) 162
BstNSI RCATGY 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 343
BstSNI TACGTA 1 cut(s) 215
BstX2I RGATCY 1 cut(s) 220
BstYI RGATCY 1 cut(s) 220
BsuRI GGCC 2 cut(s) 78, 141
BtsCI GGATG 1 cut(s) 200
Cac8I GCNNGC 1 cut(s) 100
CfoI GCGC 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 140
Csp6I GTAC 3 cut(s) 212, 320, 352
CviAII CATG 2 cut(s) 43, 84
CviJI RGCY 5 cut(s) 9, 26, 78, 141, 173
CviKI_1 RGCY 5 cut(s) 9, 26, 78, 141, 173
CviQI GTAC 3 cut(s) 212, 320, 352
DdeI CTNAG 1 cut(s) 294
DpnI GATC 3 cut(s) 41, 222, 330
DpnII GATC 3 cut(s) 39, 220, 328
Eam1104I CTCTTC 1 cut(s) 373
EarI CTCTTC 1 cut(s) 373
Eco105I TACGTA 1 cut(s) 215
Eco31I GGTCTC 2 cut(s) 21, 86
Eco47III AGCGCT 1 cut(s) 157
FaeI CATG 2 cut(s) 46, 87
FaiI YATR 5 cut(s) 44, 64, 85, 236, 261
FatI CATG 2 cut(s) 42, 83
FbaI TGATCA 1 cut(s) 39
Fnu4HI GCNGC 1 cut(s) 10
FokI GGATG 1 cut(s) 187
Fsp4HI GCNGC 1 cut(s) 10
FspBI CTAG 2 cut(s) 6, 153
GlaI GCGC 1 cut(s) 157
GluI GCNGC 1 cut(s) 10
HaeII RGCGCY 1 cut(s) 159
HaeIII GGCC 2 cut(s) 78, 141
HhaI GCGC 1 cut(s) 158
Hin1I GRCGYC 1 cut(s) 267
Hin1II CATG 2 cut(s) 46, 87
Hin6I GCGC 1 cut(s) 156
HinP1I GCGC 1 cut(s) 156
HinfI GANTC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 272
Hpy188III TCNNGA 3 cut(s) 119, 204, 326
Hpy99I CGWCG 1 cut(s) 272
HpyCH4III ACNGT 1 cut(s) 344
HpyCH4IV ACGT 2 cut(s) 214, 267
HpyCH4V TGCA 2 cut(s) 71, 303
HpyF10VI GCNNNNNNNGC 1 cut(s) 162
HpyF3I CTNAG 1 cut(s) 294
HpySE526I ACGT 2 cut(s) 214, 267
Hsp92I GRCGYC 1 cut(s) 267
Hsp92II CATG 2 cut(s) 46, 87
HspAI GCGC 1 cut(s) 156
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 3 cut(s) 39, 220, 328
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 5 cut(s) 81, 84, 127, 217, 330
MaeI CTAG 2 cut(s) 6, 153
MaeII ACGT 2 cut(s) 214, 267
MaeIII GTNAC 2 cut(s) 196, 307
MalI GATC 3 cut(s) 41, 222, 330
MboI GATC 3 cut(s) 39, 220, 328
MboII GAAGA 1 cut(s) 360
MflI RGATCY 1 cut(s) 220
MluCI AATT 4 cut(s) 182, 312, 357, 373
MmeI TCCRAC 3 cut(s) 112, 170, 250
MnlI CCTC 4 cut(s) 89, 153, 303, 333
MseI TTAA 1 cut(s) 376
MwoI GCNNNNNNNGC 1 cut(s) 162
NdeII GATC 3 cut(s) 39, 220, 328
NlaIII CATG 2 cut(s) 46, 87
NmuCI GTSAC 1 cut(s) 307
NspI RCATGY 1 cut(s) 87
PciI ACATGT 1 cut(s) 83
PfeI GAWTC 1 cut(s) 109
PkrI GCNGC 1 cut(s) 11
Ppu21I YACGTR 1 cut(s) 215
PscI ACATGT 1 cut(s) 83
PspPI GGNCC 1 cut(s) 140
PsuI RGATCY 1 cut(s) 220
RsaI GTAC 3 cut(s) 213, 321, 353
RsaNI GTAC 3 cut(s) 212, 320, 352
SaqAI TTAA 1 cut(s) 376
SatI GCNGC 1 cut(s) 10
Sau3AI GATC 3 cut(s) 39, 220, 328
Sau96I GGNCC 1 cut(s) 140
SetI ASST 6 cut(s) 11, 175, 217, 270, 309, 325
SfcI CTRYAG 1 cut(s) 343
SnaBI TACGTA 1 cut(s) 215
Sse9I AATT 4 cut(s) 182, 312, 357, 373
SsiI CCGC 1 cut(s) 96
SspMI CTAG 2 cut(s) 6, 153
TaaI ACNGT 1 cut(s) 344
TaiI ACGT 2 cut(s) 217, 270
TasI AATT 4 cut(s) 182, 312, 357, 373
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 1 cut(s) 376
Tru9I TTAA 1 cut(s) 376
TseFI GTSAC 1 cut(s) 307
TseI GCWGC 1 cut(s) 9
Tsp45I GTSAC 1 cut(s) 307
TspDTI ATGAA 2 cut(s) 248, 251
XceI RCATGY 1 cut(s) 87
XspI CTAG 2 cut(s) 6, 153
ZraI GACGTC 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.