Rw6G003610

Belongs to the plant LTP family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
5931551 .. 5932117
567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G003610.1

Sequence Viewer

Length: 366 bp
ATGACTAGTTGCTGGTCTCTCTTGGCTTTTGGTATTGTGATCAAGGTGTTGATCATCAGTCCATATCCTGCAAATGGCCTCACATGCGATGAGACCGCAGGCATTTTGAATCCATGTCAAGATTTTTTGGTTGGAAATGGCCCTCCAACTCCTAGCGCTTCTTGCTGTGGAGCTGTGAAAGAATTGGTTTCTAAAGTTACATCCAGACAAGTACGTAGAGATTTGTGTGAATGTATGAAGCAGATTATTCTTGCCTTTCATATTGACGTCGGAAAACTTCAATACATCATTCCTCAGTATTGCAAGGTCAGAATTCCTGTACCTCTTGATCCCAACGCAGACTGCAGCAAGGCTTCTCTGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

13.13

Weight (kDa)

8.08

Isoelectric Point (pI)

42.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 20 - 106 5.5e-08 Probable lipid transfer
Tryp_alpha_amyl PF00234 29 - 115 8.8e-07 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 270
AciI CCGC 1 cut(s) 96
AclWI GGATC 1 cut(s) 323
AcsI RAATTY 1 cut(s) 312
AcyI GRCGYC 1 cut(s) 267
AfaI GTAC 2 cut(s) 213, 321
AfeI AGCGCT 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 2 cut(s) 109, 281
AhlI ACTAGT 1 cut(s) 5
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
Alw26I GTCTC 2 cut(s) 21, 86
AlwI GGATC 1 cut(s) 323
Aor51HI AGCGCT 1 cut(s) 157
AoxI GGCC 2 cut(s) 76, 139
ApeKI GCWGC 1 cut(s) 345
ApoI RAATTY 1 cut(s) 312
AspLEI GCGC 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 140
BbvI GCAGC 1 cut(s) 357
BclI TGATCA 2 cut(s) 39, 51
BcoDI GTCTC 2 cut(s) 21, 86
BcuI ACTAGT 1 cut(s) 5
BfaI CTAG 2 cut(s) 6, 153
BfmI CTRYAG 1 cut(s) 343
BfoI RGCGCY 1 cut(s) 159
BisI GCNGC 1 cut(s) 346
BlsI GCNGC 1 cut(s) 347
BmgT120I GGNCC 1 cut(s) 140
BsaAI YACGTR 1 cut(s) 215
BsaHI GRCGYC 1 cut(s) 267
BsaI GGTCTC 2 cut(s) 21, 86
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseGI GGATG 1 cut(s) 200
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 308
BseXI GCAGC 1 cut(s) 357
BshFI GGCC 2 cut(s) 78, 141
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 2 cut(s) 21, 86
BsnI GGCC 2 cut(s) 78, 141
Bso31I GGTCTC 2 cut(s) 21, 86
Bsp143I GATC 3 cut(s) 39, 51, 328
BspACI CCGC 1 cut(s) 96
BspANI GGCC 2 cut(s) 78, 141
BspCNI CTCAG 1 cut(s) 307
BspMAI CTGCAG 1 cut(s) 347
BspPI GGATC 1 cut(s) 323
BspTNI GGTCTC 2 cut(s) 21, 86
BssMI GATC 3 cut(s) 39, 51, 328
BssNI GRCGYC 1 cut(s) 267
BstACI GRCGYC 1 cut(s) 267
BstBAI YACGTR 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 1 cut(s) 200
BstH2I RGCGCY 1 cut(s) 159
BstHHI GCGC 1 cut(s) 158
BstKTI GATC 3 cut(s) 42, 54, 331
BstMAI GTCTC 2 cut(s) 21, 86
BstMBI GATC 3 cut(s) 39, 51, 328
BstMWI GCNNNNNNNGC 2 cut(s) 84, 162
BstNSI RCATGY 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 343
BstSNI TACGTA 1 cut(s) 215
BstV1I GCAGC 1 cut(s) 357
BsuRI GGCC 2 cut(s) 78, 141
BtgZI GCGATG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 200
Cac8I GCNNGC 1 cut(s) 100
CfoI GCGC 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 140
Csp6I GTAC 2 cut(s) 212, 320
CviAII CATG 2 cut(s) 84, 114
CviJI RGCY 5 cut(s) 26, 78, 141, 173, 353
CviKI_1 RGCY 5 cut(s) 26, 78, 141, 173, 353
CviQI GTAC 2 cut(s) 212, 320
DdeI CTNAG 1 cut(s) 294
DpnI GATC 3 cut(s) 41, 53, 330
DpnII GATC 3 cut(s) 39, 51, 328
Eco105I TACGTA 1 cut(s) 215
Eco31I GGTCTC 2 cut(s) 21, 86
Eco47III AGCGCT 1 cut(s) 157
EcoRI GAATTC 1 cut(s) 312
FaeI CATG 2 cut(s) 87, 117
FaiI YATR 5 cut(s) 64, 85, 115, 236, 261
FatI CATG 2 cut(s) 83, 113
FbaI TGATCA 2 cut(s) 39, 51
Fnu4HI GCNGC 1 cut(s) 346
FokI GGATG 1 cut(s) 187
Fsp4HI GCNGC 1 cut(s) 346
FspBI CTAG 2 cut(s) 6, 153
GlaI GCGC 1 cut(s) 157
GluI GCNGC 1 cut(s) 346
HaeII RGCGCY 1 cut(s) 159
HaeIII GGCC 2 cut(s) 78, 141
HhaI GCGC 1 cut(s) 158
Hin1I GRCGYC 1 cut(s) 267
Hin1II CATG 2 cut(s) 87, 117
Hin6I GCGC 1 cut(s) 156
HinP1I GCGC 1 cut(s) 156
HinfI GANTC 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 272, 311
Hpy188III TCNNGA 3 cut(s) 119, 204, 326
Hpy99I CGWCG 1 cut(s) 272
HpyCH4IV ACGT 2 cut(s) 214, 267
HpyCH4V TGCA 3 cut(s) 71, 303, 345
HpyF10VI GCNNNNNNNGC 2 cut(s) 84, 162
HpyF3I CTNAG 1 cut(s) 294
HpySE526I ACGT 2 cut(s) 214, 267
Hsp92I GRCGYC 1 cut(s) 267
Hsp92II CATG 2 cut(s) 87, 117
HspAI GCGC 1 cut(s) 156
Ksp22I TGATCA 2 cut(s) 39, 51
Kzo9I GATC 3 cut(s) 39, 51, 328
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 4 cut(s) 81, 84, 217, 330
Lsp1109I GCAGC 1 cut(s) 357
MaeI CTAG 2 cut(s) 6, 153
MaeII ACGT 2 cut(s) 214, 267
MaeIII GTNAC 1 cut(s) 196
MalI GATC 3 cut(s) 41, 53, 330
MboI GATC 3 cut(s) 39, 51, 328
MluCI AATT 2 cut(s) 182, 312
MmeI TCCRAC 3 cut(s) 112, 170, 250
MnlI CCTC 4 cut(s) 89, 153, 303, 333
MseI TTAA 1 cut(s) 364
MwoI GCNNNNNNNGC 2 cut(s) 84, 162
NdeII GATC 3 cut(s) 39, 51, 328
NlaIII CATG 2 cut(s) 87, 117
NspI RCATGY 1 cut(s) 87
PfeI GAWTC 1 cut(s) 109
PkrI GCNGC 1 cut(s) 347
Ppu21I YACGTR 1 cut(s) 215
PspPI GGNCC 1 cut(s) 140
PstI CTGCAG 1 cut(s) 347
RsaI GTAC 2 cut(s) 213, 321
RsaNI GTAC 2 cut(s) 212, 320
SaqAI TTAA 1 cut(s) 364
SatI GCNGC 1 cut(s) 346
Sau3AI GATC 3 cut(s) 39, 51, 328
Sau96I GGNCC 1 cut(s) 140
SetI ASST 6 cut(s) 48, 175, 217, 270, 309, 325
SfcI CTRYAG 1 cut(s) 343
SnaBI TACGTA 1 cut(s) 215
SpeI ACTAGT 1 cut(s) 5
Sse9I AATT 2 cut(s) 182, 312
SsiI CCGC 1 cut(s) 96
SspMI CTAG 2 cut(s) 6, 153
TaiI ACGT 2 cut(s) 217, 270
TasI AATT 2 cut(s) 182, 312
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 1 cut(s) 364
Tru9I TTAA 1 cut(s) 364
TseI GCWGC 1 cut(s) 345
TspDTI ATGAA 2 cut(s) 248, 251
XapI RAATTY 1 cut(s) 312
XceI RCATGY 1 cut(s) 87
XspI CTAG 2 cut(s) 6, 153
ZraI GACGTC 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.