Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6C

Orthogroup ID

OG0004839

Physical Location & Seq

Genomic Coordinates Reverse (-)

3385562 .. 3390409

Gene Structure 4848 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6CG036200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 624 bp

ATGACTAGCTGCTGGTCTCTCTTGGCTTTTGGTATTGTGATCATGGTGTTGATGATCAGTCCATATCCTGCAAATGGCCTCACATGCGATGAGACCGCAGGAATTTTGAATCCCTGTCAAGATTTTTTGGTTGGAAATGGCCCTCCAACTCCTAGCGCTTCTTGCTGTGGAGCTGTGAAAGAATTGGTTTCTAAAGTTACATCCAGACAAGTACGCAGAGATCTGTGTGAATGTATGAAGCAGATTATTCTTGCCTTTCATATTGACGTCGGAAAACTTCAATACATCATTCCTCAGTATTGCAAGGTCACAATTCCTGTACCTCTTGATCCCAACGCAGACTGCAGCAATCCCCGTCGGAGCCACAGTGATCAGCCTTATGTTTTCAATGTCAAGATTCTTCATGCCCATTGCAAGGCTCAATCGAAGTTCTTTGGAGAGGCTGACATCTCACTCAACCTCTTCCTTCTTTTACCAACAACTGAGTCTGCAGAAGCTGTTGCAATCTCCTTCAGTTCTCGTATAGTCACCTGCCAACGTGGTTTTTGCAACATGAAGGCGCCTACAGTGATGGAAGCAAGGGTTGCACATAACCCTCATGGTACCTGTGCCTTTAAAACCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LTP_2 Tryp_alpha_amyl

Protein Analysis

207

Amino Acids

22.62

Weight (kDa)

8.22

Isoelectric Point (pI)

38.94

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LTP_2	PF14368	19 - 106	1.3e-07	Probable lipid transfer
Tryp_alpha_amyl	PF00234	29 - 115	3.3e-06	Protease inhibitor/seed storage/LTP family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004839)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g02840 FvH4_3g01190
malus_domestica	MD10G1328900.v1.1
prunus_persica	Prupe.4G013200_v2.0.a1 Prupe.4G217000_v2.0.a1
pyrus_communis	pycom10g27860
rosa_chinensis	RchiOBHm_Chr5g0047311 RchiOBHm_Chr5g0075671 RchiOBHm_Chr6g0247621
rosa_laevigata	RLG00000015189 RLG00000034489
rosa_multiflora	Rmu_sc0000580.1_g000125 Rmu_sc0003092.1_g000052 Rmu_sc0003441.1_g000086
rosa_roxburghii	Rroxscaffold_1G00034040 Rroxscaffold_7G00213830
rosa_rugosa	Rorug05G0235600 Rorug05G0527600
rosa_samantha	Rh5AG314700 Rh5DG334200 Rh6AG040900 Rh6AG041200 Rh6AG041900 Rh6BG036300 Rh6BG036500 Rh6BG036800 Rh6CG036200
rosa_wichuraiana	Rw5G029420 Rw5G046240 Rw6G003590 Rw6G003610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	539
AatII	GACGTC	1 cut(s)	270
Acc36I	ACCTGC	1 cut(s)	539
Acc65I	GGTACC	1 cut(s)	602
AccB1I	GGYRCC	2 cut(s)	559, 602
AciI	CCGC	1 cut(s)	96
AclWI	GGATC	1 cut(s)	323
AcsI	RAATTY	1 cut(s)	102
AcuI	CTGAAG	1 cut(s)	496
AcyI	GRCGYC	2 cut(s)	267, 560
AfaI	GTAC	3 cut(s)	213, 321, 604
AfeI	AGCGCT	1 cut(s)	157
AfiI	CCNNNNNNNGG	2 cut(s)	74, 415
AgsI	TTSAA	3 cut(s)	109, 281, 388
AluBI	AGCT	3 cut(s)	9, 173, 497
AluI	AGCT	3 cut(s)	9, 173, 497
Alw26I	GTCTC	2 cut(s)	21, 86
AlwI	GGATC	1 cut(s)	323
AlwNI	CAGNNNCTG	1 cut(s)	497
Aor51HI	AGCGCT	1 cut(s)	157
AoxI	GGCC	2 cut(s)	76, 139
ApeKI	GCWGC	2 cut(s)	9, 345
ApoI	RAATTY	1 cut(s)	102
Asp718I	GGTACC	1 cut(s)	602
AspLEI	GCGC	2 cut(s)	158, 562
AspS9I	GGNCC	1 cut(s)	140
AsuHPI	GGTGA	1 cut(s)	520
BanI	GGYRCC	2 cut(s)	559, 602
BbvI	GCAGC	1 cut(s)	357
BccI	CCATC	1 cut(s)	565
BclI	TGATCA	3 cut(s)	39, 54, 370
BcoDI	GTCTC	2 cut(s)	21, 86
BfaI	CTAG	3 cut(s)	6, 153, 622
BfmI	CTRYAG	3 cut(s)	343, 489, 564
BfoI	RGCGCY	2 cut(s)	159, 563
BfuAI	ACCTGC	1 cut(s)	539
BglII	AGATCT	1 cut(s)	220
BisI	GCNGC	2 cut(s)	10, 346
BlsI	GCNGC	2 cut(s)	11, 347
BmgT120I	GGNCC	1 cut(s)	140
BmiI	GGNNCC	3 cut(s)	362, 561, 604
BsaHI	GRCGYC	2 cut(s)	267, 560
BsaI	GGTCTC	2 cut(s)	21, 86
BsaXI	ACNNNNNCTCC	2 cut(s)	352, 382
Bsc4I	CCNNNNNNNGG	2 cut(s)	74, 415
Bse3DI	GCAATG	1 cut(s)	409
BseGI	GGATG	1 cut(s)	200
BseLI	CCNNNNNNNGG	2 cut(s)	74, 415
BseMI	GCAATG	1 cut(s)	409
BseMII	CTCAG	2 cut(s)	308, 474
BseXI	GCAGC	1 cut(s)	357
BshFI	GGCC	2 cut(s)	78, 141
BshNI	GGYRCC	2 cut(s)	559, 602
BslI	CCNNNNNNNGG	2 cut(s)	74, 415
BsmAI	GTCTC	2 cut(s)	21, 86
BsnI	GGCC	2 cut(s)	78, 141
Bso31I	GGTCTC	2 cut(s)	21, 86
Bsp143I	GATC	5 cut(s)	39, 54, 220, 328, 370
BspACI	CCGC	1 cut(s)	96
BspANI	GGCC	2 cut(s)	78, 141
BspCNI	CTCAG	2 cut(s)	307, 475
BspLI	GGNNCC	3 cut(s)	362, 561, 604
BspMAI	CTGCAG	2 cut(s)	347, 493
BspMI	ACCTGC	1 cut(s)	539
BspPI	GGATC	1 cut(s)	323
BspT107I	GGYRCC	2 cut(s)	559, 602
BspTNI	GGTCTC	2 cut(s)	21, 86
BsrDI	GCAATG	1 cut(s)	409
BssMI	GATC	5 cut(s)	39, 54, 220, 328, 370
BssNI	GRCGYC	2 cut(s)	267, 560
Bst4CI	ACNGT	2 cut(s)	368, 568
Bst6I	CTCTTC	1 cut(s)	467
BstACI	GRCGYC	2 cut(s)	267, 560
BstAPI	GCANNNNNTGC	1 cut(s)	584
BstDEI	CTNAG	2 cut(s)	294, 483
BstF5I	GGATG	1 cut(s)	200
BstH2I	RGCGCY	2 cut(s)	159, 563
BstHHI	GCGC	2 cut(s)	158, 562
BstKTI	GATC	5 cut(s)	42, 57, 223, 331, 373
BstMAI	GTCTC	2 cut(s)	21, 86
BstMBI	GATC	5 cut(s)	39, 54, 220, 328, 370
BstMWI	GCNNNNNNNGC	3 cut(s)	84, 162, 584
BstNSI	RCATGY	1 cut(s)	87
BstSFI	CTRYAG	3 cut(s)	343, 489, 564
BstV1I	GCAGC	1 cut(s)	357
BstX2I	RGATCY	1 cut(s)	220
BstYI	RGATCY	1 cut(s)	220
BsuRI	GGCC	2 cut(s)	78, 141
BtgZI	GCGATG	1 cut(s)	102
BtsCI	GGATG	1 cut(s)	200
BtsIMutI	CAGTG	2 cut(s)	373, 573
BveI	ACCTGC	1 cut(s)	539
CaiI	CAGNNNCTG	1 cut(s)	497
CfoI	GCGC	2 cut(s)	158, 562
Cfr13I	GGNCC	1 cut(s)	140
Csp6I	GTAC	3 cut(s)	212, 320, 603
CviAII	CATG	5 cut(s)	43, 84, 404, 553, 599
CviQI	GTAC	3 cut(s)	212, 320, 603
DdeI	CTNAG	2 cut(s)	294, 483
DinI	GGCGCC	1 cut(s)	561
DpnI	GATC	5 cut(s)	41, 56, 222, 330, 372
DpnII	GATC	5 cut(s)	39, 54, 220, 328, 370
DraI	TTTAAA	1 cut(s)	616
Eam1104I	CTCTTC	1 cut(s)	467
EarI	CTCTTC	1 cut(s)	467
Eco31I	GGTCTC	2 cut(s)	21, 86
Eco47III	AGCGCT	1 cut(s)	157
Eco57I	CTGAAG	1 cut(s)	496
EgeI	GGCGCC	1 cut(s)	561
EheI	GGCGCC	1 cut(s)	561
FaeI	CATG	5 cut(s)	46, 87, 407, 556, 602
FatI	CATG	5 cut(s)	42, 83, 403, 552, 598
FbaI	TGATCA	3 cut(s)	39, 54, 370
Fnu4HI	GCNGC	2 cut(s)	10, 346
FokI	GGATG	1 cut(s)	187
Fsp4HI	GCNGC	2 cut(s)	10, 346
FspBI	CTAG	3 cut(s)	6, 153, 622
GlaI	GCGC	2 cut(s)	157, 561
GluI	GCNGC	2 cut(s)	10, 346
HaeII	RGCGCY	2 cut(s)	159, 563
HaeIII	GGCC	2 cut(s)	78, 141
HhaI	GCGC	2 cut(s)	158, 562
Hin1I	GRCGYC	2 cut(s)	267, 560
Hin1II	CATG	5 cut(s)	46, 87, 407, 556, 602
Hin6I	GCGC	2 cut(s)	156, 560
HinP1I	GCGC	2 cut(s)	156, 560
HinfI	GANTC	3 cut(s)	109, 397, 485
HphI	GGTGA	1 cut(s)	520
Hpy188I	TCNGA	2 cut(s)	272, 360
Hpy188III	TCNNGA	4 cut(s)	119, 204, 326, 394
Hpy99I	CGWCG	2 cut(s)	272, 360
HpyAV	CCTTC	3 cut(s)	476, 520, 550
HpyCH4III	ACNGT	2 cut(s)	368, 568
HpyCH4IV	ACGT	2 cut(s)	267, 538
HpyCH4V	TGCA	8 cut(s)	71, 303, 345, 414, 491, 503, 549, 587
HpyF10VI	GCNNNNNNNGC	3 cut(s)	84, 162, 584
HpyF3I	CTNAG	2 cut(s)	294, 483
HpySE526I	ACGT	2 cut(s)	267, 538
Hsp92I	GRCGYC	2 cut(s)	267, 560
Hsp92II	CATG	5 cut(s)	46, 87, 407, 556, 602
HspAI	GCGC	2 cut(s)	156, 560
KasI	GGCGCC	1 cut(s)	559
KpnI	GGTACC	1 cut(s)	606
Ksp22I	TGATCA	3 cut(s)	39, 54, 370
Kzo9I	GATC	5 cut(s)	39, 54, 220, 328, 370
LmnI	GCTCC	2 cut(s)	170, 360
LpnPI	CCDG	7 cut(s)	81, 84, 127, 217, 330, 544, 619
Lsp1109I	GCAGC	1 cut(s)	357
MaeI	CTAG	3 cut(s)	6, 153, 622
MaeII	ACGT	2 cut(s)	267, 538
MaeIII	GTNAC	3 cut(s)	196, 307, 526
MalI	GATC	5 cut(s)	41, 56, 222, 330, 372
MboI	GATC	5 cut(s)	39, 54, 220, 328, 370
MboII	GAAGA	2 cut(s)	392, 454
MflI	RGATCY	1 cut(s)	220
MluCI	AATT	3 cut(s)	102, 182, 312
Mly113I	GGCGCC	1 cut(s)	560
MlyI	GAGTC	1 cut(s)	494
MmeI	TCCRAC	4 cut(s)	112, 170, 250, 338
MnlI	CCTC	7 cut(s)	89, 153, 303, 333, 433, 470, 606
MseI	TTAA	1 cut(s)	615
MwoI	GCNNNNNNNGC	3 cut(s)	84, 162, 584
NarI	GGCGCC	1 cut(s)	560
NdeII	GATC	5 cut(s)	39, 54, 220, 328, 370
NlaIII	CATG	5 cut(s)	46, 87, 407, 556, 602
NlaIV	GGNNCC	3 cut(s)	362, 561, 604
NmuCI	GTSAC	2 cut(s)	307, 526
NspI	RCATGY	1 cut(s)	87
PaqCI	CACCTGC	1 cut(s)	539
PfeI	GAWTC	2 cut(s)	109, 397
PkrI	GCNGC	2 cut(s)	11, 347
PleI	GAGTC	1 cut(s)	493
PluTI	GGCGCC	1 cut(s)	563
PpsI	GAGTC	1 cut(s)	493
PspN4I	GGNNCC	3 cut(s)	362, 561, 604
PspPI	GGNCC	1 cut(s)	140
PstI	CTGCAG	2 cut(s)	347, 493
PstNI	CAGNNNCTG	1 cut(s)	497
PsuI	RGATCY	1 cut(s)	220
RsaI	GTAC	3 cut(s)	213, 321, 604
RsaNI	GTAC	3 cut(s)	212, 320, 603
SaqAI	TTAA	1 cut(s)	615
SatI	GCNGC	2 cut(s)	10, 346
Sau3AI	GATC	5 cut(s)	39, 54, 220, 328, 370
Sau96I	GGNCC	1 cut(s)	140
SchI	GAGTC	1 cut(s)	494
SfcI	CTRYAG	3 cut(s)	343, 489, 564
SfoI	GGCGCC	1 cut(s)	561
Sse9I	AATT	3 cut(s)	102, 182, 312
SsiI	CCGC	1 cut(s)	96
SspDI	GGCGCC	1 cut(s)	559
SspMI	CTAG	3 cut(s)	6, 153, 622
TaaI	ACNGT	2 cut(s)	368, 568
TaiI	ACGT	2 cut(s)	270, 541
TaqI	TCGA	1 cut(s)	425
TasI	AATT	3 cut(s)	102, 182, 312
TfiI	GAWTC	2 cut(s)	109, 397
Tru1I	TTAA	1 cut(s)	615
Tru9I	TTAA	1 cut(s)	615
TscAI	CASTG	2 cut(s)	373, 573
TseFI	GTSAC	2 cut(s)	307, 526
TseI	GCWGC	2 cut(s)	9, 345
Tsp45I	GTSAC	2 cut(s)	307, 526
TspDTI	ATGAA	4 cut(s)	248, 251, 392, 569
TspRI	CASTG	2 cut(s)	373, 573
XapI	RAATTY	1 cut(s)	102
XceI	RCATGY	1 cut(s)	87
XspI	CTAG	3 cut(s)	6, 153, 622
ZraI	GACGTC	1 cut(s)	268

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.